20 Questions 31 Answers 0 Followers
Questions related from Saeid Afshar
Recently I want to download the FDA approved drugs but unfortunately I couldn't retrieve data correctly . How can I download this data in SDF format?
29 March 2020 4,080 3 View
I use salting out DNA extraction methods . But recently after adding the ethanol we couldn't saw the DNA skein and DNA pellet . Finally the results of nano drop indicated that extracted DNA have...
21 September 2019 2,773 1 View
Recently we evaluate the serum IL-6 level in patients after radiotherapy . Unfortunately 4 of 7 samples are negative. we used the thermo fisher ELISA kit for this aim and 100 microliter of...
21 August 2019 8,681 4 View
I want to evaluate the ionizing radiation effects on miRNA expression level in mice. Some paper used PBMCs and others used whole blood ( WBC ) for RNA extraction . is there difference between...
26 May 2019 4,923 4 View
Recently we want to target a gene with siRNA , but i have a critical question how can i make sure that downstream pathway of this genes will be affected . on the other hand ho can i predict...
26 November 2017 1,163 3 View
Recently two study indicated that mineral oil can be used for Dna extraction. Is there anyone who has the experience about this method?
09 November 2017 1,367 4 View
I want to perform meta analysis for gene expression data of cell lines . how can i perform quality assessment for such data type ? i think that PRISMA must be modified for such data.
19 September 2017 9,935 3 View
I want to extract the secreted and cellular protein. How can i perform it by lysate buffer?
08 September 2017 1,685 0 View
What is the mechanism of emission of labled sirna by fam. I have the question about emition ability of unlocalaized dye.
09 June 2017 8,913 2 View
I order the polyfect transfection reagent (Cat No./ID: 301105) . can use it for transfection of mimic mirna?
21 January 2017 9,411 4 View
I want to order primer sets of RT-qPCR for miRNA detection based on the P K Busk et al paper ( without probe ) . Is the DNA Reverse Phase Column purification method is proper for this aim ?
03 December 2016 919 2 View
I designed the primer sets for miR-625 , but i have the problem with C-DNA synthesis for real-time PCR. i need the protocol of C-DNA synthesis . Is there anyone to help me about the reagents ,time...
28 November 2016 8,010 7 View
I want to analyse cell cycle with flow cytometry "partec " applying PI. i used abcam protocol for staining with PI and fixation with 66% ethanol. SSC vs FSC plot is scattered very broad . how...
03 September 2016 7,118 3 View
I have survival fraction data of to cell line in different radiation dose.how can I calculate alpha and beta and how can I fit graph to this data with graphpad prism 6 software .on the other hand...
29 June 2016 7,237 4 View
I want to analyse difference between to dependent variable based on the time . How can i analyse this difference with spss?
07 June 2016 7,037 3 View
I search ncbi for rora gene of mice and find mrna accesion numer (nm).I can't accesion number nm in rat but 3 xm accesion numbers were found. Can I designprimers for this gene in rat based on the...
20 April 2016 5,546 3 View
I design primer for foxo3 mRNA (exon junction ) but when i check it for specifity it bind to the genomic sequence with same prduct length . F: GGCAAAGCAGACCCTCAAAC R: AACGGTATCACTGTCCACTTG
17 April 2016 7,346 4 View
In order to analyse the effects of 5-fu on hct116 cells viability , I performed MTT assay(24h) for different doses of 5-fu(0.1mM to 80mM). Based on the results of 24h MTT : viability of control...
25 December 2015 497 4 View
in recent study , i want to plot ROC curve with nominal data vs standard gold? is it possible to use nominal data for ROC ?
29 November 2015 5,475 2 View
I visit the atcc web page but there isnt any information about the origin of hct116 cell line. Is there anyone who know more abote the origine of this cell line Please help me . Thank you
28 October 2015 6,816 4 View
