Does the amount of ammonium measured by the electrode depend on temperature?

19 November 2020 6,315 12 View

I am seeking for a Questionnaire which is in this book: Consumption Values and Market Choices: Theory and Applications, does anyone have access to it?

For my new research, I need a questionnaire regarding consumption value theory (specially conditional value questions), Sheth 1991 has a standard questionnaire in his book which is named...

02 May 2020 731 2 View

What do you think about resilient supply chain?

According to the spreed of COVID-19 ,many supply chains all around the world, have been affected by negative impacts of this virus, especially in countries with the highest prevalence. In this...

11 March 2020 7,035 9 View

Is there any reference value that can be compared to the obtained health risk index (HRI)?

In order to evaluate the risk from tomato ingestion in the presence of organic wastes, health risk index (HRI) of heavy metals in each treatment were calculated . Is there any reference value...

14 July 2019 8,279 1 View

What is the probable reason for mismatch between results of fluorescent microscopy and flow cytometry?

I used a GFP vector to evaluate the transfection efficiency. the negative control, is a GFP-free vector. results of Fluorescent microscopy show transfection at rates higher than 90%. But the...

20 September 2018 1,346 6 View

Correlation coefficent of two catagorical variables

Hello, Is there anyway to have the correlation coefficient of two categorical variables ,both ordinal and nominal (For example level of education and ethnicity)? I have checked the independency by...

30 July 2017 3,229 3 View

Phosphoserine simulation using Gromacs

Hi Dear all I want to simulate a protein containing phosphoserine using MD, so I place the force field into the working directory and modified all parameters such as SEP (phosphoserine) was added...

15 June 2017 960 8 View

Can anyone help me about PCR of DNA extrected from Mia-paca-2 cell line?

Dear all, I should extract DNA from some cancer cell lines and perform PCR for its. I did it by Qiagen kit. From among all, PCR of DNA from Mia-paca-2 cell line (cell line of Pancreatic cancer)...

23 September 2015 6,523 3 View

I want to test the effect of lacking a gene on male infertility. How many male I should mate? and how many female I have to mate with the KO male?

06 August 2015 3,293 1 View

Which kit is more accurate for determination of protein concentration in SDS- Page sample buffer?

Which kit is more accurate for determination of protein concentration in SDS- Page sample buffer?1- Protein assay kit (Bio-RAD)2- 660 nm protein assay (Thermo scientific)3- 2-D quant kit (GE...

20 August 2014 9,614 10 View

Can anyone help me how to get the similar bands in Actin?

I run western blot on HCT-116 cell lines, I got actin band like in the attached picture. The band size is not same. Can anyone help me explain this situation and how to overcome? Thank you your...

22 February 2021 6,937 3 View

Hi, can anybody help me with the suggestions how can I amplify a stress induced gene of 1107 bp?

I am trying to amplify the TGA1 (Transcription factor 1 ) of Arabidopsis ,which is 1107 bp. I have treated the plants with Salycylic solution over night and extracted the RNA and make cDNA. I...

17 February 2021 7,802 2 View

Why are my western blot bands so distorted?

Hi guys I'm out of ideas here please help! I've never had consistent problem like this doing westerns before and I can't figure it out. The condition used: - First 4 lanes have 50ug protein in...

04 February 2021 2,297 3 View

After G actin polymerization and labelling I didn't got filaments. Why?

Purified G actin and got 42kda band and an additional band just below it. While performing G actin polymerization and labeling with rhodamine-phalloidin I didn't observe filaments under the...

20 January 2021 3,751 2 View

Why am I seeing multiple bands for beta-actin PCR?

I performed a PCR run on human DNA with the beta-actin primer (F: GCCATCCTGCGTCTGGACCTGGCT; R: GTGATGACCTGGCCGTCAGGCAGC). PCR setting: 98degree 30sec, 30cycle of (98degreeC 10sec, 64degree 30s,...

14 January 2021 6,544 2 View

What is the reason for observing two bands of beta-actin after lipofectamine transfection of keratinocytes cells?

25 December 2020 8,668 3 View

What all factors do we have to consider to interpret cytocompatibility of a nanomaterial from Actin DAPI stained images of HOS cells cultured with it?

Phalloidin stained filaments and dapi stained nucleus

08 December 2020 8,548 3 View

What is the difference between actin and loading control in normalization of western blot???

Regarding normalization of western blot analysis, I have found different strategies people follow but I couldn't understand the principle and which one is the accurate, 1- some refer to loading...

04 December 2020 5,721 8 View

How to quantify cellular B-actin?

Hello community, I have stained my tissue for actin by Phalloidin staining, but now I would like to quantify actin concentrations in my samples. What would be a good method? Thank you!

03 November 2020 3,160 2 View

Dear all! I would like to stain the actin filaments in live cells. Could you recommend me a dye which do not block the actin polymerization?

25 October 2020 4,887 5 View