I have got miseq data for 16S rRNA In this I have some over represented sequences(shown in fastqc) which does not have proper Barcodes/Primers labelled to it. These over represented sequences are "TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGTCAATCTCGTATGC" and "GATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTA". I extracted these sequences from fastq file and tried blast and RDP classifier to identify what it is but didn't get any hit. If someone have faced the same issue can enlighten me what these sequences are?
Thank you,
Best,
Richa
¿You have two gene sequences 16s and you want to identify microorganisms?
First of all you need to provide the pipeline how did you get these sequences without adaptors/barcodes etc (filtering, trimming of raw data from basespace etc.) since they are too short even for Illumina. And the length is most probable reason why you have not achieved any significant BLAST results.
Thank for the reply,
1) I have just one and would like to find the 16s bacterial profile.
2) I found these sequences in fastqc and grep these ones from my raw data. So generally for normal case one could do Demultiplexing to find the labels of samples using (mothur/qiime). But the here in my case few sequences were not tagged with barcodes and primers and contained overrepresented sequences. These overrepresented sequences are just small section of whole sequence. for example
>seq
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGTCAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAATTTTTTCCCTCCCTTCTTCCTTCTCCTTTTTTTTTCTTCTCTTTCTCTCTTCTTTTCCTCCTTTCCCCTCTTTTTTCTCCCTTTTTTCTCTTCCTCTTTTTTCCCTTTTTTTTCTCTCTTTCTTTTTTTTTCCTCCTTTTTTTTTCCCTTTCTTCTCCCCTCTTCTTTTCCCTCTTTTTCTCTTCTACATCCCTTCTTTCTCCTCTTTCCTCTCTCTTTCTCTTTTTC
Although, my major focus is do quality control and technically when I will do filtering step these sequences will automatically be filtered out but just out of curiosity wanted to know what these are.
Thanks
ok, I`m not sure I have an answer in this case.
I did BLAST and found that this fragment are highly identical (94% with almost full coverage - around 50 nt) to many "Cyprinus carpio genome assembly common carp genome" scaffolds, hense, possibly it has some kind of sense. However, I don`t know how it could be happened these sequences were without barcodes/primers if you performed 16S amplification first?
@Richa: The first thing to do is the check if your over-represented sequence matches your adaptor or primer. Also reverse complement the adaptor/primer and check against your over-represented sequence, just in case. If your MiSeq data has barcodes and primers, the analysis tools like Qiime or Mothur will remove them provided the barcodes and primers are provided in a mapping file.
Ilya V Kublanov
I did amplification for ITS regions for plant material looking for fungal species, but I tested one of the clusters for the same Index but different tags, and it gives me in Blast: "Cyprinus carpio genome assembly common carp genome" scaffolds as well, which sounds super weird for me.
- Badges
- Science topic
- Similar topics
- Computer Science and Engineering
- Bioinformatics