Which reference manager software—Mendeley or EndNote—is the best?

More Nadeem Rais's questions See All

How can I find the cracked version of ENVI-met software?

Envi-met software

07 August 2024 8,188 1 View

Entropy measure and QSPR modeling in Graph Theor. How to construct the table for lengthy equation?

The entropy measured of molecular graphs plays a crucial rule. The network structures in some cases are very lengthy calculations to handle. Some author avoid to construct table where as most...

30 July 2024 3,126 0 View

Critique Calculaltion in Topological Indices and QSPR Modeling?

The first step is to analyze a 2D molecular graph and implement partitioning techniques to calculate the topological indices. Secondly impose statically tools to generate QSPR model, may or may...

24 July 2024 9,644 1 View

What strategy should be adopted to calculate topological indices efficiently?

Most of the time it is observed that in many manuscripts there are several typo error of topological calculation errors of calculation and partition of edges what ever the type of partitioning it...

22 July 2024 811 0 View

Nicotiana benthamiana seeds sterilization methods for tissue culturing?

I have been trying to grow Nicotiana benthamiana via tissue culture. I used ethanol and sodium hypochlorite with different concentrations and time duration for seeds sterilization and lastly...

18 June 2024 1,756 3 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,777 1 View

QSPR model is not fit for or it does not deliberate best answers. How we can improve it?

The QSPR analysis some time fails to produce relevant answer. what we should do to get improve results.

29 August 2023 7,764 2 View

What the difference exists between the QSPR analysis by using 2D and 3D model of drugs structures?

Where as some authors use 2d model and other use 3d model. How we can distinguish what the difference. Are the results same or different?

27 August 2023 552 2 View

How to establish a Mathematical Model on "Transfer of heat in human body organs"?

I'm looking for a mathematical model for transfer of heat in human body organs especially (eye, heart, brain and lungs). How is the behavior of heat transfer at normal and extreme levels

12 July 2023 4,888 2 View

What is the prepared reference material that can be used in inductively coupled plasma optical emission spectrometry (ICP-OES) to measure REE and U ?

What is the prepared reference material that can be used in the ICPE-9820 Shimadzu Japan instrument, which employs inductively coupled plasma optical emission spectrometry (ICP-OES) to measure...

06 August 2024 1,896 1 View

Why citations appear multiple times after inserting new citation or using refresh in Mendeley word plugin?

this happens in all words documents in my device even if I am working on a new sheet! I have turned off the tack changes bottom but didn't work as well!

06 July 2024 934 0 View

How to produce homogeneous reference gene bands in Western Blot?

Hello, I have been performing Western Blots to study the protein levels of a rodent skin and muscle sample. However, I have not been able to produce homogenous reference bands. I suspect that...

26 June 2024 5,913 3 View

Cancer biology reference book?

Anyone can suggest me a good reference book on cancer biology that covers drug delivery and discovery as well as basic concenpts of cancer biology?

25 June 2024 9,245 1 View

What to do when you have reached the treshold of references in EndNote?

Dear fellows, yesterday, when trying to register another reference in EndNote, I got the message that the library was full. It has more than 5000 references. I wonder thus, what is the smartest...

25 June 2024 6,903 1 View

Is it advisable to run reference genes separately from target genes in a comparative Ct analysis on ABI StepOnePlus due to logistical constraints?

Hi Everyone, I'm reaching out for some guidance regarding conducting a comparative Ct analysis with the ABI StepOnePlus system, and I hope you can help shed some light on my dilemma. Here's the...

11 June 2024 4,044 3 View

Why am I having huge shifts in reference genes Cq's?

I was recently performing a great deal of qPCRs on adipose tissue derived RNA. I had experimental samples from sick, and control samples from healthy individuals. I used the same chemistry for all...

04 June 2024 6,924 0 View

How to insert numbered references in EndNote that assign a new number even for repeated citations?

Dear colleagues I have to prepare a document for Oxford University Publishing group that follows an unusual way of listing references. It requires that references meet two conditions: All are...

28 May 2024 5,612 4 View

Could someone help a right procedure for TGA analysis of cement?

I analyzed cement samples exposed and unexposed to moisture over various periods. The TGA results of these samples showed variation with each repetition. However, I consistently used calcium...

22 May 2024 1,339 3 View

What to do with primer efficiencies ?

Hello - planning a SYBR Green qPCR study. I have primer efficiencies, including for reference genes, from 90-105% I am planning to use efficiency correction in my calculations - do I correct for...

15 May 2024 3,370 0 View