I have isolated fungi from a diseased fruit and cultured this fungi in Petri plates. Which protocol should I follow to extract the DNA of these unknown fungi? What strategy, I should use to do PCR? More importantly which primers I use for identification of species level as well as genus level??
Dear Aqleem Abbas,
DNeasy Plant Mini Kit (Qiagen) for extraction.
and there are couple of more kits available.
Please also refer following link for PCR and sequencing.
Validation of a Quick PCR Method Suitable for Direct Sequencing: Identification of Fusarium Fungal Species and Chemotypes for Preventive Approaches in Food Safety
Marine Pallez · Matias Pasquali · Torsten Bohn · [...] · Marco Beyer
Fungal DNA isolation - ResearchGate. Available from: https://www.researchgate.net/post/Fungal_DNA_isolation2 [accessed Feb 15, 2017].
Dear Aqleem Abbas
You can use TE DNA extraction method, this is a short and fast way to extract fungal DNA:
1. Add 50 ul TE buffer (Tris HCL, pH 8.0, 10 ml/ 1M + EDTA, pH 8.0, 2 ml/ 0.5 M + 1000 ml distilled water) in 0.2 ml tube.
2. Add a very small piece of fungus mycellium from young culture by using a sterile toothpick and squish it.
3. Put the tube in PCR Thermal cycler and set 95 C for 10 min.
4. Incubate in 4 C for one night (overnight).
Now you can use this DNA for PCR product:
Add Distilled water 14.2 ul, PCR buffer 2.5 ul, Mgcl2 1ul, dNTP 1ul, Primer forward 1ul, Primer reverse 1ul, Taq 0.3 ul, DNA template 4 ul in 0.2 ml tube and then put the tube in PCR Thermal cycler.
Primers: I prefer to use ITS primers such as ITS4 (TCC TCC GCT TAT TGA TAT GC) and ITS5 (GGA AGT AAA AGT CGT AAC AAG G). I attached a pdf file "primers" contained useful primers you can use.
PCR strategy:
Stage primary denaturing: 95 C, 5 min, 1 Cycle
Stage denaturing: 95 C, 1min
Stage annealing: 57 C (55-60 C) 1 min, 35 Cycle
Stage extension: 72 C, 1 min
Stage final extension: 72 C, 7 min, 1 Cycle
Stage storage at 4 C.
Run the PCR products on agarose 1.5% to see PCR product band.
Finally, You have to send your PCR product to one of sequencing centers in your country.
Dear Aqleem Abbas,
To identify fungi on primarily basis at genus level you can use ITS1 (5΄- TCCGTAGGTGAACCTGCGG- 3΄) and ITS4 (3΄- TCCTCCGCTTATTGATATGC-5΄) primers. Once you identify at genus level you can use specific primers that help you to identify fungus at species level.
I've used Zymo Fungal/Bacterial DNA MiniPrep kits with great success, extracting DNA for Sanger sequencing. What ever method you choose, bead beating/mechanical disruption may be a useful first step. As others have said, ITS1/ITS4 is a good choice for primers.
Hi Aqleem
You can use ITS primer as ITS 1 = Forward and ITS4 = reverse
Also, can use see some Reference1
https://www.btsjournals.com/assets/2015v6p14-20.pdf
3
https://bmcmicrobiol.biomedcentral.com/articles/10.1186/1471-2180-5-28
I think you can use the following primers, and then sequencing and bioinformatics:
forward primer ITS1 (5’ TCC GTA GGT GAA CCT GCG G 3’) and reverse primer ITS4 (5’ TCC TCC GCT TAT TGA TAT GC 3’) (White et al., 1990)
Hello researcher
I will suggest you do the PCR then you can do RAPD using OPA and OPN primers it will enable you to your identification of your isolates to species level
For fungi in Mediterranean
The nuclear ribosomal internal transcribed spacer (ITS) was amplified using the ITS1f (5′- ACACTGACGACATGGTTCTACACTTGGTCATTTAG AGGAAGTAA) and ITS2 (5′- TACGGTAGCAGAGACTTGGTCTGCT GCGTTCTTCATCGATGC) primers (White et al. 1990).
ITS1 &ITS4 primers are used for fungal identification. You can also used specie specific primer for identification
- Badges
- Science topic
- Similar topics
- Microbiology
- Assays