I'm working on a suspected ARE region in a 3'UTR of a transcription factor. Using the ARED website we've found that there are two "AUUUA" pentamers in our 3'UTR that are close together that suggests the presence of an ARE. What I'm unsure of is where the actual ARE begins and ends (e.g. how many G and C's can be in the ARE? Do I have two small AREs or one big ARE?)
Hi,
Here is the region of my UTR that has the two pentamers (bolded):
UAAAUACCCGUUACCAUAUUUAUCCAUUUGUAAUUAAAUUAUGGUAUUAACUUGCUACAGAGGAAACAAUAUUUAUAAAGAAUGUUUCUUAA
Is my ARE the entire region or do I have two small ARE's surrounding the "AUUUA" pentamers? The A and U rich regions continues on after this sequence for another ~50 bp, so should this region also be included in the ARE?
All of the literature that I've read seems unclear on what defines the beginning and ending of the ARE region so if anyone could help clarify this, it's appreciated.
Kristen
Hi,
The definition of an ARE is still a work in progress. It began as AUUUA and single/overlapping copies of this pentamer. However, it is clear that many ARE RNA-binding proteins have a range of specificities and thus AREs do as well. I think of them as U rich stretches (>3) separated by A,C,G.
I would recommend trying this script because it tells you about AU rich blocks too:
http://arescore.dkfz.de/arescore.pl
Alternatively, if you are looking at human RNA you could check if one of the ARE-RBPs have binding sites from CLIP data in your region of interest here:
http://dorina.mdc-berlin.de/
check for ELAVL1, TIA1, ZFP36 sites
let me know if you have more questions
Hi,
The definition of an ARE is still a work in progress. It began as AUUUA and single/overlapping copies of this pentamer. However, it is clear that many ARE RNA-binding proteins have a range of specificities and thus AREs do as well. I think of them as U rich stretches (>3) separated by A,C,G.
I would recommend trying this script because it tells you about AU rich blocks too:
http://arescore.dkfz.de/arescore.pl
Alternatively, if you are looking at human RNA you could check if one of the ARE-RBPs have binding sites from CLIP data in your region of interest here:
http://dorina.mdc-berlin.de/
check for ELAVL1, TIA1, ZFP36 sites
let me know if you have more questions
Hi Neelanjan,
Thank you for this answer. It was very helpful. The ends of my ARE are still a little uncertain but I think the only way for me to be sure is via experiments.
Thanks again,
Kristen
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Biology
- Molecular Biological Techniques