I'm working on a suspected ARE region in a 3'UTR of a transcription factor. Using the ARED website we've found that there are two "AUUUA" pentamers in our 3'UTR that are close together that suggests the presence of an ARE. What I'm unsure of is where the actual ARE begins and ends (e.g. how many G and C's can be in the ARE? Do I have two small AREs or one big ARE?)

Hi,

Here is the region of my UTR that has the two pentamers (bolded):

UAAAUACCCGUUACCAUAUUUAUCCAUUUGUAAUUAAAUUAUGGUAUUAACUUGCUACAGAGGAAACAAUAUUUAUAAAGAAUGUUUCUUAA

Is my ARE the entire region or do I have two small ARE's surrounding the "AUUUA" pentamers? The A and U rich regions continues on after this sequence for another ~50 bp, so should this region also be included in the ARE?

All of the literature that I've read seems unclear on what defines the beginning and ending of the ARE region so if anyone could help clarify this, it's appreciated.

Kristen

More Kristen S Barratt's questions See All
Similar questions and discussions