Hi All,

I have a protein sequence cloned in pET21+ vector.

Below is the part of the sequence starting from T7 promoter to the ATG (of my protein):

TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGGATCCTCTAGAAGGAGGACAACCATG

Protein is not expressing at al, I am using BL21 DE3 for the expression. I am only curious to know that does this sequence have Ribosome binding site/SD? Or is this sequence correct for the expression of my protein?

More Rohit Singh's questions See All
Similar questions and discussions