2 Questions 3 Answers 0 Followers
Questions related from Najoua Mghazli
Dear community, I am working on a metabarcoding dataset and I want to run SpiecEasi for network. Given that I have a large dataset I tried to use only the 50 first records using the following:...
05 June 2023 2,278 4 View
I want to use the primer Fw_ITS1 (5'- AGGAGAAGTCGTAACAAGGT -3') to amplify algae but I don't seem to find the original paper of this primer. I can find it in most articles referred to White et...
27 December 2022 9,774 2 View