Dear Sir/Mam, I am constructing vector/plasmid with Lac Z alpha gene. I have doubt the following sequence is correct to insert Lac Zalpha- "cattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcttgcatgcctgcaggtcctcgaattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgcgatcttcctgaggccgatactgtcgtcgtcccctcaaactggcagatgcacggttacgatgcgcccatctacaccaacgtgacctatcccattacggtcaatccgccgtttgttcccacggagaatccgacgggttgttactcgctcacatttaatgttgatgaaagctggctacaggaaggccagacgcgaattatttttgatggcgttcctattggttaaaaaat". Please tell me this is enough to insert in to some plasmids without LacZalpha gene.
Well, I have no experience in plasmid construction, so I cannot give you a very detailed advice but you can check for presence of a promoter, operator, terminator, ribosome binding site and ORF using nucleotide databases or online prediction tools.
Probably a better advice I can give is to refer to sequence maps of existing vectors such as pUC18 and pUC19 which contain LacZ gene and are amenable to blue-white screening.
- Badges
- Science topic