I have been trying to prepare a PCR library after doing the ChIP-Nexus protocol. After ligating the adapters and doing the required reaction (barcode filling on opposite strand and digesting the original adapter strand), I go on with making PCR library using the primer sets given in the protocol.

From what I understand, since the template in this case is a single stranded circular DNA molecule, and they suggest to use Q5 from NEB for PCR amplification of the product, it seems to be similar to the rolling circle process of amplification, with the only difference being that since q5 does not have strand displacement activity, with every round of amplification, it would generate a new amplicon from the template strand.

My confusion lies here,

There are 2 primers which are used in reaction. One is called Universal primer and the other one is indexed primer for sequencing. But both of them have binding site on the template (the ligated adapter) in exactly the same orientation giving me the idea that the first reaction would happen with universal primer and it makes a stranded circular DNA fragment and next this fragment gets denatured in two, and the next indexed primer makes amplification cycles.

It seems REALLY confusing to me at this point. Below are the sequences for adapter and primers:

The actual template that I would get after ChIP-nexus steps and adapter ligation (This fragment is circularised to obtain a ssccDNA):

5’ TfbindingfootprintFlankingSequenceAGATCGGAAGAGCACACGTCTGGATCCACGACGCTCTTCCGATCTNNNNNGACT 3’

Focusing just on the Adapter ligated to the DNA fragment (I am using this as a reference to make ssccDNA molecule by removing the sequence that I would obtain from ChIP steps, the GACT is a unique barcode and NNNNN are random bases )

5’ AGATCGGAAGAGCACACGTCTGGATCCACGACGCTCTTCCGATCTNNNNNGACT 3’

Primer universal

5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3’

Primer Indexed 1

5’ CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T 3’

And also why are the primers so long? When the binding region is so small. If its not understandable from the above explanation, please refer to this protocol and paper (https://research.stowers.org/zeitlingerlab/documents/20210812_ChIP-nexus-protocol.pdf , Article Chromatin accessibility in the Drosophila embryo is determin...