30 June 2017 5 3K Report

this is a flagellate algae of freshwater. diameter of this algae is about 0.010mm

More Fateme Khademen's questions See All
Is this a facetotecta nauplius?

This larva was captured using a plankton net in the Persian Gulf during the summer. I believe it may be a Facetotecta nauplius.

08 August 2024 3,746 4 View

How to use CINPE4 elements in ABAQUS for infinite boundaries?

Hi All, I have used infinite elements in Abaqus to absorb waves at the sides and bottom boundaries of the soil domain. but the boundary reflected wave can not be completely absorbed on the...

06 June 2024 448 4 View

How merge output files of simulation with NAMD?

I have been running steered molecular simulation with NAMD, but in the middle of my simulation it has stopped and i have restarted from specific steps which had stopped. Finally i have two parts...

19 May 2024 1,483 2 View

What is the reason of pattern of lithography in center of wafer are thicker in comparison of edges of the wafer?

Hello When we pattern a mask in a wafer, after exposure we noticed that the length of our patterns in the center of our wafer is thicker in copmarison with edges of it. What is the reason and...

22 April 2024 6,796 4 View

Why exon number change by zooming out in Genome Browser?

Why does the number of exons of PTPRQ change by zooming out in Genome Browser site? the NM number is: NM_001145026.2

21 April 2024 8,336 1 View

No matches result in silico PCR at Genome Browser webpage!?

I want to check my designed primers by in silico PCR in Genome Browser. but always face with this message [ No matches to cagatgagtcagtgccgttag agtaggtgctgactggttcc in Human Feb. 2009...

06 April 2024 3,951 4 View

What is the role of surface tuxture in anti gravel coatings?

Anti gravel or stone chip resistant coatings are often defined as textured coatings. Does the tuxtured surface play a role in the coating performance, especially in anti gravel properties?

22 March 2024 7,758 0 View

Have you ever run a steered molecular dynamic simulation with NAMD?

Hi everyone. Is there anybody here who have run a steered molecular dynamic simulation with NAMD and knows about the parameters which i have to write in my configuration file?

05 March 2024 7,935 1 View

How can the bitter taste from calcium chloride treatment in a protein product be minimized while maintaining the desired texture?

Greetings esteemed colleagues, I am currently working on my master's thesis, focusing on a protein product that requires the use of calcium chloride treatment in one of its stages to form calcium...

24 February 2024 1,806 2 View

How could i minimize and equilibrate system with available output files of CHARMM-GUI for NAMD?

I have downloaded output files of CHARMM-GUI for NAMD which i had made membrane-protein complex with CHARMM-GUI and now i don't know what should i do with these files before running simulation...

13 February 2024 4,182 0 View

Similar questions and discussions
Is there any cases algae not using the nutrient from the wastewater and grow normally?

I am working on microalgae cultivation using waste water. The initial concentration of nutrients were less but the microalgae has achieved biomass growth of 2 g/L. The final concentration of...

08 August 2024 4,812 2 View

I need help with Identification (misidentification) of European Pisidiidae & Sphaeriidae?

Hi everyone! I published an article summarizing my first experience in determining cryptic species of small bivalves, of course with errors. I will be very grateful and will thank you in future...

02 August 2024 6,582 11 View

Hello researchers, how can one get the optical density of a filamentous algae?

i am comparing the growth performances of filamentous and non filamentous forms. in a case where I can not count the cells of the filamentous algae using a hemocytometer, is it okay to do a...

30 July 2024 5,985 2 View

Is it common for heterotrophic bacteria to grow on Pro99 and SNAX media?

I am attempting to isolate picocyanobacteria from seawater (pre-filtered with a GF/D membrane) using the pour plate technique and filter plating method (Kearney et al., 2022) on Pro99 and SNAX...

30 July 2024 1,040 1 View

Which filtration method to go for run off water from dirty solar panels to be used again?

We are working on a robot that cleans solar panels using fresh water supply and a rotating brush. We are trying to conserve as much water at possible by recycling the dirty water that is collected...

28 July 2024 5,778 2 View

In passive sampling, can polymer-lipid partition coefficients be applied independent of environmental salinity?

For example, if low-density polyethylene (LDPE) is equilibrated with PCB contaminated marine and freshwater sediments, can LDPE-lipid partition coefficients be used to obtain equilibrium...

28 July 2024 263 1 View

Which statistical test would be the best?

For my practical project at Uni, I am researching blue-green algae in a freshwater lake. I have three locations around the lake and am testing the water for phosphates, pH, and temperature. I am...

30 June 2024 4,264 3 View

Is it legally permissible to reuse algae biomass following the treatment of non-hazardous laboratory waste?

Hello, community, Could you please clarify whether current legislation permits the reuse of algae biomass after it has been used to treat non-hazardous decontaminated laboratory organic waste?...

05 June 2024 5,040 1 View

What prepair food for carnivore fresh water planarians ?

I want have carnivore and detritivore planarians in captivity and i dont now what is the best way for to prepair food for them.

01 June 2024 3,110 3 View

Algae contamination on hydroponic cultures for Arabidopsis thaliana?

Hi everyone, I'm having trouble with my hydroponic cultures for Arabidopsis thaliana, since lately I've started having algae contamination on them. I have tried using several sterilization...

21 May 2024 4,840 1 View

Our partners will collect data and use cookies for ad personalization and measurement. Learn how we and our ad partner Google, collect and use data. Agree & close