What are the thermal properties values of thermal conductivity, specific heat for Jute ?

More Murlidhar Meghwal's questions See All

How to distill N,N- Dimethyl Formamide DMF?

I wanted to know procedure and mechanism for the distillation of Formamide,, N-methyl Formamide, N,N- Dimethyl Formamide DMF. and drying procedure.

26 January 2023 1,685 2 View

How do I simulate a multi-BS 5G network in NetSim?

I need to do a system-level simulation of a 5G network where I can define parameters like location/mobility of UEs, channel models for pathloss/shadowing/fading, handover parameters such as time...

30 December 2021 9,106 12 View

Is anybody having research paper on stolon synchronization and tuber initiation in potato seed ?

is anybody having research paper on stolon synchronization and tuber initiation in potato seed

27 July 2021 9,752 1 View

How to complete education PG level degree projetc, when everything is closed due to CORONA pandemic and labs are closed?

What can be possible ways to complete the requirement of PG level final year projects in on Food science, food nutrition and food technolgy, with quality work under such crucial time of pandemic...

23 June 2021 669 2 View

How can I select the best plasmid after sequencing?

I have transformed a drought-related gene of 1.7kb into pGEMt vector (E.coli DH5 alpha strain). After sequencing the plasmids (3 replicates) 4 changed amino acids are visible at different...

06 February 2021 600 3 View

What can be the problem in the isolation of Plasmid?

I've tried transformation of a 1.7 kb gene with DH5 alpha strain of competent cells and also used PuC19 as a control. After selecting colonies and broth-culturing overnight, I isolated plasmid....

27 December 2020 3,820 5 View

How can i reduce primer dimers and get my cDNA PCR amplification done?

I am performing High-fidelity general PCR using Takara PrimeSTAR™ HS DNA Polymerase , but there is no amplification and very dense bands of primer dimers are visible. the cDNA is of superior...

24 March 2020 1,786 3 View

Why not antibacterial biosurfactant act on producer bacteria?

Bacteria have been reported for the production of wide range of biosurfactants. Some biosurfactants have antibacterial and antifungal activities in which they targets cell wall and cell membranes....

30 June 2018 5,727 3 View

Is the Indian minimum seed certification satnadards available for karonda (Carissa carandas)? If not what should be the standards for karonda

This is required for getting the new varieties released from state seed sub committee

08 August 2017 4,697 2 View

Amplification of nifH and nodA gene in Rhizobium sp. resulted multiple bands, what is an efficient way to get single band?

Primers USED nifH1 Forward CGTTTTACGGCAAGGGCGGTATCGGCAnifH2 Reverse TCCTCCAGCTCCTCCATGGTGATCGG nodA1 forward TGCRGTGGAARNTRNNCTGGGAAA nodA2 reverse GGNCCGTCRTCRAAWGTCARGTA

18 February 2016 2,981 3 View

How to fix errors in my heat transfer steel structure with reinforced concrete slab model Abaqus?

I have modelled a steel structure using beam elements in Abaqus and attached to this structure reinforced concrete slab. The analysis that I am making is heat transfer of the structure. The...

07 August 2024 1,028 0 View

How does grain and grain boundary affect the ceramic when studying its dielectric properties?

I am not able to get good literature and the physics behind how first these grains and grain boundaries arises out of no where when we make a pellet to study its dielectric properties and then how...

07 August 2024 5,177 3 View

Why does my protein refolded to beta sheet during thermal denaturation analysis?

Hi! So i attempted to understand a novel protein behavior towards heat application by analyzing its secondary structure change. I subjected the protein to a thermal denaturation analysis using...

06 August 2024 1,989 3 View

How to heat polymer for about 130° without oil bath ?

is there any other way to heat a polymer evenly other than oil bath if so what are those and how to use it

06 August 2024 947 1 View

What should I do with parameters that are not relate to my simulation in MyLake model?

I want to Estimate surface heat fluxes using MyLake, but I don't have all the initial values in model parameters section and other sections,is there a way?

04 August 2024 1,537 1 View

Can't spin-orbit coupling(SOC) be included in optical properties calculation in CASTEP?

I am currently using CASTEP version 2020. When I want to run optical properties calculations with spin-orbit coupling(SOC), I encounter the following error in a pop-up window before the job gets...

02 August 2024 2,890 0 View

How to build my own lab made four point probe set up?

Hello, I'm trying to measure the conductivity of semiconductor films but since I don't have a commercial four point probe set up I would like to build one on my own in my lab. I have generators,...

30 July 2024 906 2 View

How to calculate conductivity using Electrochemical Impedance Spectroscopy's Nyquist plot?

Hello everyone, I am new to this characterization but watching videos on youtube I have already plotted a Nyquist plot (Z' and -Z'') and already fitted models on my material using Zsim. But now I...

29 July 2024 1,376 0 View

What are the perfect mathematical model for a solar-powered ship implementation?

A computational study of heat flux on cylindrical surfaces using CNT hybrid nanofluids

28 July 2024 4,985 1 View

Seeking recommendations for equipment to mimic sunlight and heat up a greenhouse system?m?

I would like to conduct artificial sunlight experiments to mimic heat capture and air warming in a greenhouse system. The main objective is to heat up the temperature inside the greenhouse, not...

28 July 2024 4,006 2 View

James Garry

Murlidhar,

I suspect that c, and k are strongly affected by moisture content. So, for what it's worth:

http://jute.org/composition.html

Note the thermal properties are listed without stating the moisture content.

You may want to have some samples actually measured to deduce practical values.

Murlidhar Meghwal

Thank you very much Dr James Garry ..it is very useful information for me

Jasim Ahmed

Put your sample in a DSC and examine it. It will take 30 min only if you run 10 or 20C/min.

If you do not send me.