Why does a Nested PCR protocol amplify samples and not amplify positive control?

I have this problem. Today I used a new positive control of an isolated NC-1 strain in cell culture and the problem persists. I performed a serial dilution test to test the sensitivity of the...

08 December 2020 6,252 2 View

How to avoid the formation of traces and dimers in DNA gel electrophoresis?

07 December 2020 3,052 3 View

Is the pipetting order of the positive and negative controls in the PCR important to avoid in a possible contamination?

I have been watching bands form on my negative controls. I have already changed all reagents, optimized the hygiene of materials and the environment and increased care in pipetting.

07 December 2020 9,090 3 View

How to standardize and obtain a good PCR reaction with samples with a low and variable amount of DNA?

I work with the detection of N. caninum DNA in milk samples in milk samples. The DNA concentrations in my samples range between 2-90 ng / ul. I would like to establish and standardize a final...

01 December 2020 8,792 3 View

Measure of intracellular lactate?

Hi! I will try to measure intracellular lactate through lysing the cells in 20 mM Tris-HCl, 150 mM NaCl and 1% NP40. I'm going to use a clinical kit, which is constituted of Pipes buffer, pH 6.8....

30 January 2020 5,211 2 View

Dissolved oxygena DYE for cell culture?

Hi, I am looking for a dye to monitor O2 changes in cell culture media. I would like to have it colorimetric and not fluorescent but since I am not finding anything I could to fluorescent too! I...

23 October 2018 5,895 2 View

How do I determine the sample size to evaluate the performance of an image segmentation algorithm?

I have three image segmentation techniques that I have developed. I wish to compare the performance of the segmentation techniques using measures such as BDE(boundary displacement error),...

11 October 2018 2,021 5 View

Most appropriate Feature Selection to find indicators that are most correlated to the number of one event?

I have two databases. One of them contains the number of this event per year. The other one contains a lot of indicators and its values per year. I want to find those indicators that are most...

20 March 2018 3,610 4 View

Which is the best way to treat ticks and fleas for morphological identification before performing molecular investigations?

Hello all, I am trying to attempt morphological identification of ticks and fleas collected in Wales on wild small rodents. My samples have been frozen and after the morphological identification I...

10 October 2017 7,374 4 View

Is it a problem to have a positive dG in primer self dimer?

5' GGCATGTAACGAATTTCTTC 3' +++ ||| 3' CTTCTTTAAGCAATGTACGG 5'dG: 1.5 Data from Gene Runner

24 May 2015 4,243 6 View

Sample dilution for quantitative analysis using ELISA?

If the detection range is in ng/ml but the reference range is in ug/ml for a molecule or protein in serum or plasma .how to dilute and what is the initial volume to be taken for quantitative analysis

02 March 2021 7,670 3 View

How to add missing citation?

Dear colleagues, I have found that many authors have a concern regarding their missing citation in RG because often citation in RG is lower than google scholars. I also missed some citation...

26 February 2021 928 6 View

Standard curve shifting over time. How do I stabilise the ELISA?

24 February 2021 1,365 3 View

Concentration of DNA?

Hello everyone! Is a normal value 295.8 ug/ul for cDNA? If not what does it mean? Where is the mistake? The measurement was done with nano drop. Thank you!

09 February 2021 6,202 1 View

What is the reference value of THD in BLDC MOTOR speed control ?

i used to control EHO+ANFIS to MRPID to Landsman converter for bldc drive i got 7% but some of them are telling IEEE standards are < 5% is it correct for Drives ?

07 February 2021 5,892 1 View

How to do DNA normalization based on qPCR values?

Hi Everyone: I have a question regarding to qPCR. I am trying to do RT-PCR, and I want to have equal amount of input DNA for my RT-PCR, so I normalize my DNA input based on qPCR values of a...

31 January 2021 6,977 4 View

How to know the threshold limit value of a sar image...??

i want to do thresholding by segregation of water areas from non water areas for that i am using model maker in ERDAS but i am unable to get the threshold limit value of my image.

26 January 2021 8,277 1 View

No title

14 January 2021 8,086 37 View

What are the most important values we should teach to our students?

In one of my articles "The need for a values-based university curriculum" https://www.universityworldnews.com/post.php?story=2019092415204357 I propose that higher education should adopt a...

14 January 2021 2,304 95 View

What can be the reason of having high Cq-values for reference genes?

Hi, Once again I am facing an annoying problem. This time in my barley qPCR, I am trying to detect a virus (BYDV) in plant samples. I get rather high Cq-values for 2 of the 3 reference genes...

06 January 2021 4,685 9 View