What are the parameters for selecting transcription factors bound to the promoter region of fruit cuticle wax biosynthesis?

03 May 2020 0 3K Report

Badges
Science topic

Similar topics
Filing

More Hafiz Muhammad Rizwan's questions See All

I'm interested to quantify Urea by HPLC method, reversed phase conditions are preferable. Is there a good method suited for urea?

I have to develop a method that can be good enough to run dozens of samples that include urea as the main compound. I prefer an HPLC method because of the convenience of running large numbers of...

01 February 2021 1,888 4 View

How to convert ng/ul of DNA concentration to pmol/ul ?

Dear researcher, After amplifying my target gene (1900bp) into the required cDNA by PCR,>cut specific gel bands and purify the gel and the concentration was 30ng/ul. Next, performed A-Tailing...

21 January 2021 2,671 3 View

Can use Unigenes from RNA sequences for overexpression studies (transformation) without requiring a specific plant genome?

Dear researchers: If the plant genome has not been released yet, can Unigenes from RNA sequences be used after BLAST and confirmed with known Arabidopsis genes for function/overexpression...

20 January 2021 5,557 2 View

What is the reason of weight gain in TGA curve of a HDPE polymer sample ?

HDPE samples were aged at higher temperatures in the presence of water and CO2 than the TGA test was performed in Nitrogen? Weight gain is seen in the curve? What could be the possible reason for...

16 January 2021 5,644 2 View

Can BLAST/ search by using known Domain in Transcriptome/Genome data for a gene family?

Dear Researchers, I have Transcriptome/Genome data and want to list all the member of a KCS/CER gene family whose Domain AP2/ERF, FAE1_CUT1, according to the Arabidopsis database, so is there...

15 January 2021 2,293 3 View

Is it necessary to measure the concentration of PCR/Gel purified product for A-tailing and TA cloning?

Dear Researchers, While working on plant gene transformation, so after cDNA + Gene Primer amplification, >the PCR/Gel were purified, so next for A-tailing and TA cloning is mandatory to...

12 January 2021 3,272 34 View

Can use the same vector for overexpression and transient expression?

Dear Researchers, I am using pCAMBIA1301/1302 vectors for overexpression study, so can use the same vectors for transient expression? or need to design another vector for transient expression;...

08 January 2021 7,975 2 View

Why negative controls also showing the specific bands of promotor and other regions (GUS, GFP etc.)?

Dear Researchers, I did a transformation of an empty vector (pCAMBIA1301/1302) into my passion fruit plants, for the optimization of the transformation protocol. After transformation; DNA...

06 January 2021 8,465 99 View

Can anybody help me out in TRNSYS about short term thermal energy storage used as buffer storage ..?

i am a beginner in trnsys and need help ... can anyone please guide me

20 December 2020 1,040 3 View

Smear in PCR product after purification, how to get rid of it?

I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...

28 November 2020 1,701 7 View

How to eliminate Steady state error from Reinforcement learning genetic algorithm code?

The following code (see 1st 2 images attached) is used to produce PID controller values that are designed to control the system (G). The code finds the PID controller values (noted as k) by using...

28 February 2021 6,560 14 View

How to immerse bricks in wax ( for coating ) ?

Do we immerse the bricks horizontally or vertically ? #bricks#waterproofingsurface#civil#engeenering#chemicalengineering#wax#parafinwax

28 February 2021 6,685 2 View

Can I use acetic acid with an ELITE WAX Perkin Elmer column for Gas Chromatography?

Hi! I would want to know if I can use acetic acid with an ELITE WAX Perkin Elmer column for Gas Chromatography. This column has a polyethylene glycol phase, but I can't find the manual to check...

22 February 2021 730 2 View

How to constrain genetic algorithm input u?

My real system (buck converter) can only take an input of 0 to 1 (duty ratio) and I need to constrain the system so the controller action keeps within this bounds. How can I do this? The code for...

22 February 2021 2,125 3 View

How can I improve the concentration of banana fruits extracted RNA?

Currently, I'm working with banana fruits. I've tried to do RNA extractions with different methods, and I've gotten total RNA without contamination, but I couldn't get a high concentration of...

22 February 2021 6,126 2 View

Choice of Ab for Co-IP: Does an anti-(tag) antibody (such as anti-flag/ anti-myc) a must if I am using co-transfected cells for Co-IP?

Hi guys, I am trying to detect the binding of 2 proteins by Co-immunoprecipitation. However, the choice of antibody is confusing me. I tried probing the endogenous protein right away but the...

16 February 2021 9,050 5 View

Does calculating the interaction index between a drug and a food matrix make sense?

Dear all, I'm conducting the revisions of some of my manuscript, with is the impact of the combination of Aspirin and a fruit juice in colorectal cancer cells. Two of the reviewers have asked to...

16 February 2021 3,141 3 View

Is Genetic Algorithm usage for Motor Conception FEA optimization a good choice?

Hi RG community, Like the title shows ,i was wondering if choosing the GA for this kind of Optimizaiton is a good choice? For example we have a population of 100 (for 7-8 Optimization Variables),...

14 February 2021 1,160 7 View

What can explain a low expected heterozygosity rate for T. monococcum wild samples (0.09) ?

I conducted an SDS PAGE electrophoresis on wheat wild varieties to separate their glutenins and measure the genetic diversity of my sample. I only ran one electrophoresis. Can a genetic drift...

14 February 2021 3,971 1 View

Kinetics of Enzyme production in Recombinant E Coli?

Hello, I am trying to find kinetic information (such as rate of enzyme production etc.) on the expression of taq polymerase in E-Coli after inserting a recombinant plasmid. Any help would be...

12 February 2021 1,386 3 View