Recently, I have been attempting to use fluorescence PCR to detect UGT1A1*28. I utilized the primers and probe reported in the paper "Rapid Allelic Discrimination by TaqMan PCR for the Detection of the Gilbert's Syndrome Marker UGT1A1*28."
Primer forward
5′-AACATTAACTTGGTGTATCGATTGGT-3′
Primer reverse
5′-AGCAGGCCCAGGACAAGT-3′
Probe (TA)6
6-FAM-5′-TTGCCATATATATATATATAAGTAGGA-3′-MGB
Probe (TA)7
VIC-5′-TGCCATATATATATATATATAAGTAGGA-3′-MGB
Initially, capillary electrophoresis revealed that the amplification efficiency of the primers reported in the literature was low, so I redesigned a pair of amplification primers.
RT-UGT1A1-28-F2
AACTCCCTGCTACCTTTGTGG
RT-UGT1A1-28-R2
GCTCCTGCCAGAGGTTCG
When testing samples using the new amplification primers and the probe from the literature, I noticed an abnormal baseline phenomenon. Instead of the baseline being a straight line, it inclined upwards. I would like to ask for possible reasons for this phenomenon to optimize subsequent experiments.
Setting the baseline too low can lead to insufficient background signal subtraction, causing affected curves to appear sigmoidal.
Use a log scale, will make your results clearer. Increasing baseline may come from a low-level but continuous degradation of your probes by the polymerase, it amplification efficiency is low
I conducted NTC testing using water as the amplification template and observed an upward tilt in the baseline. After replacing the Taq enzyme and buffer with those from TAKALA, the baseline of the amplification curve stabilized. However, I still could not distinguish between the UGT1A1 *28 and UGT1A1 *1 genotypes.
- Badges
- Science topic
- Similar topics
- Physical Sciences
- Materials Science
- Materials Chemistry
- Polymer Chemistry