well i want to amplify the a pcr product of 2kb. i am using Phusion (master mix) from Thermofischer . So I have this plasmid (addgene:28304) http://www.addgene.org/28304/
and my primers are the following:
Forward: PacI_CAG_fwd 5’-GCCTTAATTAAAATGACGTATGTTCCCAT -3’
reverse: EcoRV_LoxP_EGFP_rev 5’- GTAATCCAGAGGTTGATTATC -3’
I used from 10-200ng of the same plasmid (qiagen miniprep- purified) and the result is the same. I used a gradient PCR from the 55oC to60oC (Tm is 54,8, for 0,5uM) and still got smear on all of them. My PCr protocol is the standard from Phusion kit with Tm=54,8 or the gradient one.
Hi Iason
Try to include 6-12% DMSO in your reaction mix to increase astringency. Your primers look in the lower limit of GC content (around 40%). If DMSO fails, you can think in re-designing primers with higher GC
Best
Paco
a smear can result from one primer only annealing and extending to random lengths. Is the whole of both primer sequences complementary to the plasmid or is part of the 5' end sequence that will be useful later but does not match the target template. Only bases matching the original template can be used in calculation annealing temperatures. If this is the case then you may have to use lower annealing temperatures
My suggestions (in addition to aforementioned suggestions):
1. try using smaller volumes of reaction mixture per PCR tube (15-20 ul) and pool together if you need to scale up
2. smear in agarose gel can also result if water is used to prepare the gel instead of TE buffer
- Badges
- Science topic