Hi, can anybody help me about the Quickchange site mutagenesis PCR system? I have tried to add DMSO into the PCR system, but I cannot get the target band.
Ningning,
We use a modification of a two-step modified protocol and we've been using the Quickchange II kit.
See the following paper:
Article: Slow-inactivation induced conformational change in domain 2-segment 6 of cardiac Na+ channel. John P O'Reilly · Penny E Shockett
Jul 2006 · Biochemical and Biophysical Research Communications
Also, sometimes there is some mutant plasmid present, although a strong band is not visible.
We do not add DMSO to the reaction.
Hope this helps.
Penny
Here is a published modified protocol showed much better than the Quickchange kit. http://bmcbiotechnol.biomedcentral.com/articles/10.1186/1472-6750-8-91. The attached file is a lab protocol summarized based that publication, it is much easier to follow and proved higher efficiency.
Quick change site directed mutagenesis kit normally works good. Did you play around with annealing temperatures? what are your positive and negative controls ? How big is your plasmid ? How did you design your primers ?
Thank you very much all of you for the suggestions. The plasmid is roughly 6 Kb. I designed the primers online the www.agilent.com/genomics/qcpd. The annealing temperature is 74. I tried 74 and 72. I used phusion polymerase. PCR system 98-30s, 98-10s, 74-20s, 72-3min, 30 cicles, 72-10min. I have tried other conditions by changing concentration of DMSO,etc.
Designing the primers is the most critical factor in the QC PCR. If you designed your primers so that they are completly complemetare to each other then tthey intend to form primer dimers instead of annealing to the template which in turn decrease the efficiency of the QC PCR. So I suggest you to decrease the complementary region of the two primers by puting the nucleotide which you want to change at the 5' end if the primer instead of the middle (AAAAAAXAAAAAAAAAAAAAAAA
This usually works:
Mutagenic oligos of 25-45 bases, Tm >/= 78°C, 10-15 complementary nt on each side of the mutation, GC content of at least 40%, terminate in one or more GC (on 3'end of primer and reverse complement).
To calculate Tm = 81.5 + 0.41(%GC)-675/N-%mismatch (where N=length).
We use ~39 mers successfully often.
I strongly agree with the strategy that was suggested by Mohammed Milhim and Penny Shockett (her last answer). Full complementarity of primer pairs can prevent efficient amplification.
In case you want to use primer pairs with partial overlap, please keep in mind that you have to adopt your primer annealing temperature to just the overlapping part of your primers. Don´t use the whole primer sequence to calculate your annealing temperature.
I also like to work with PCR buffers that are optimized for DNA templates with high GC contents. These buffers are also beneficial for amplification of large DNA Fragments. The buffers should be provided in your QC-Kit.
Thanks for all of you. I have tried PCR without DMSO but cannot get product. Then I added 5% DMSO. Even though I can get the unclear band, but it usually disappears after incubating with the DpnI at 37°C.
The primers are here, the tgc/gca are inserted mutation.
F: 5’>3’ gtggaatttat tgc taaattaacctaggctgctgcc (36 bp, CG% 41.7, Tm: 78.1°C)
R: 5’>3’ ggcagcagcctaggttaattta gca ataaattccac (36 bp, CG% 41.7, Tm: 78.1°C)
You forward primer looks ok, but your reverse primer is not well designed because the mutation is very close to the 3´end.
Another thing is the Tm of your primer....dont trust online tools...in my opinion your Tm is too high. Try 60-62°C as annealing temperature! The rest of your PCR program should be ok!
For optimal PCR result your primers should be designed this way :
F: 5’>3’ gtggaatttat tgc taaattaacctaggctgctgcc
xxxxxxxxxxcaccttaaata acg atttaattgg 3`
Thanks a lot to Philip Hartz. Thank you very much. I will try to redesign the primers. But could you please tell me how do you usually calculate the annealing temperature ?
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Biology