"Pioneering Change: Exploring Veterinary Sector Startups' Impact on Animal Health" ?

29 May 2023 1 3K Report

The veterinary industry is experiencing a wave of change with the emergence of startups dedicated to revolutionizing animal health. In this article, we will explore the impact of veterinary sector startups on animal health and the broader veterinary industry. These innovative startups are introducing new technologies, service models, and approaches to veterinary care, ultimately improving the well-being of animals and transforming the way veterinarians deliver their services. Join us as we delve into the world of veterinary sector startups and their significant influence on animal health.

Jafar Sumanta Munte

Pioneering Change: Exploring the Impact of Veterinary Sector Startups on Animal Health

Badges
Science topic

More Rizwan Ghasura's questions See All

How to convert ng/ul of DNA concentration to pmol/ul ?

Dear researcher, After amplifying my target gene (1900bp) into the required cDNA by PCR,>cut specific gel bands and purify the gel and the concentration was 30ng/ul. Next, performed A-Tailing...

21 January 2021 2,671 3 View

Can use Unigenes from RNA sequences for overexpression studies (transformation) without requiring a specific plant genome?

Dear researchers: If the plant genome has not been released yet, can Unigenes from RNA sequences be used after BLAST and confirmed with known Arabidopsis genes for function/overexpression...

20 January 2021 5,557 2 View

Can BLAST/ search by using known Domain in Transcriptome/Genome data for a gene family?

Dear Researchers, I have Transcriptome/Genome data and want to list all the member of a KCS/CER gene family whose Domain AP2/ERF, FAE1_CUT1, according to the Arabidopsis database, so is there...

15 January 2021 2,293 3 View

Is it necessary to measure the concentration of PCR/Gel purified product for A-tailing and TA cloning?

Dear Researchers, While working on plant gene transformation, so after cDNA + Gene Primer amplification, >the PCR/Gel were purified, so next for A-tailing and TA cloning is mandatory to...

12 January 2021 3,272 34 View

Can use the same vector for overexpression and transient expression?

Dear Researchers, I am using pCAMBIA1301/1302 vectors for overexpression study, so can use the same vectors for transient expression? or need to design another vector for transient expression;...

08 January 2021 7,975 2 View

Why negative controls also showing the specific bands of promotor and other regions (GUS, GFP etc.)?

Dear Researchers, I did a transformation of an empty vector (pCAMBIA1301/1302) into my passion fruit plants, for the optimization of the transformation protocol. After transformation; DNA...

06 January 2021 8,465 99 View

Smear in PCR product after purification, how to get rid of it?

I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...

28 November 2020 1,701 7 View

Which is the best book about Agriculture and Ecommerce course?

Hello dear colleagues / researchers/ teachers / please suggest the best book to teach graduate students about the course "agricultural and ecommerce" , thanks in advance.

10 September 2020 2,062 9 View

Can anyone explain the dynamic relaxation in DEM??

DEM is based on the dynamic relaxation. But we use this dynamic relaxation in FEM which is based on discretizing the continuum domain and assign the lump masses at the nodes. But, we don't do this...

02 August 2020 5,012 1 View

How many references sequences should use for a phylogenetic tree construction?

I have identified fungus isolates from the fruit surface by SSU +ITS+ LSU regions, such as : 1) Fusarium kyushuense , 2) Fusarium proliferatum ;3) Aspergillus aculeatus ;4) Aspergillus europaeus...

15 July 2020 5,573 2 View

How can the use of Jolly Phonics improves the quality of reading, speaking and writing in rural disadvantaged communities in Papua New Guinea?

Jolly Phonics reading program is an effective way to teach early reading to young learners. How can lectures at the university prepare early childhood student teachers to teach Jolly Phonics to...

03 March 2021 3,731 3 View

Is there a method of determining feed digestibility without the need to re-pellet the feed?

I am aiming to determine the ADC values of a commercial fish feed, but I do not have a steam pelleter or extruder available to me. Ideally, the pellets could be coated with some inert marker....

28 February 2021 7,967 3 View

Can Ethovision store the generated data and video recordings directly to NAS system?

The size of data generated by Ethovision is huge. Having NAS system for data storage seems to be a good option, I am wondering whether Ethovision can directly store the data to the NAS system...

27 February 2021 6,350 2 View

LEDs on Vis Light photo degradation of MB water sol via N doped TiO2 in a mini flume?

Good day to all, I have no experience with light emitting diodes. I am building a glass mini flume to demonstrate the photo degradation of Methylene Blue in water running over self cleaning...

26 February 2021 4,026 5 View

Can cells be reused after using WST 8/ CCK 8 from Sigma Aldrich?

Hi all, Can cells be reused after I have seed them onto 96 well plates and test them with cell counting kit at OD450 (CCK8) at 12 hours, wash them with PBS x3 and add new media and let them...

24 February 2021 5,072 1 View

What is the optimum time and temperature of blanching and pre-frying potato for frozen fries?

I am helping a local home industry for developing frozen fries from their local farm. I want to know what is the optimum blanching and pre-frying temperature and time for processing. Please also...

23 February 2021 1,616 5 View

How we can measure Kemp % in wool without using of benzene?

Would you please let me to know about the methods for measurement of medullation and Kemp % on animal? My problem is that the wool sampling and sending to laboratory is not possible. So I would...

21 February 2021 7,260 4 View

How COVID-19 has affected mental health?

The pandemic has led to depression and anxiety and its negative effects shouldn't be ignored. However, it has also led some people to become more resilient! What do you think? Thank you.

21 February 2021 4,733 19 View

Do I need to introduce HFD to ob/ob mice to obtain a T2DM model?

I am planning to work on T2 diabetic animals and check the efficacy of probiotics. My initial plan is to fed B6 animals with HFD for a while. But now, I have the chance to work on ob/ob mice. My...

18 February 2021 6,896 3 View

FDC and FRC cell populations in mouse spleen?

I was trying to isolate fibroblastic reticular cells (FRC) and follicular dendritic cells from mice spleen, but kept getting poor yield. I found from literature that the frequency of FDC is around...

17 February 2021 3,506 4 View