Palpebral fissure narrowing in inferior oblique overaction

01 January 1970 0 2K Report

In a case of ipsilateral superior oblique palsy, can there be palpebral fissure narrowing in elevation in adduction (laevoelevation) with inferior oblique overaction? If there is minimal abduction deficit, could it be Duane syndrome? Is there superior oblique underaction in Duane?

Badges
Science topic

Similar topics
Geoscience
Cartography
Mapping

More Sana Nadeem's questions See All

How can I find the cracked version of ENVI-met software?

Envi-met software

07 August 2024 8,188 1 View

Entropy measure and QSPR modeling in Graph Theor. How to construct the table for lengthy equation?

The entropy measured of molecular graphs plays a crucial rule. The network structures in some cases are very lengthy calculations to handle. Some author avoid to construct table where as most...

30 July 2024 3,126 0 View

Critique Calculaltion in Topological Indices and QSPR Modeling?

The first step is to analyze a 2D molecular graph and implement partitioning techniques to calculate the topological indices. Secondly impose statically tools to generate QSPR model, may or may...

24 July 2024 9,644 1 View

What strategy should be adopted to calculate topological indices efficiently?

Most of the time it is observed that in many manuscripts there are several typo error of topological calculation errors of calculation and partition of edges what ever the type of partitioning it...

22 July 2024 811 0 View

Regarding solubility of Dorsomorphin in DMSO ?

I'm using Dorsomorphin (C24H25N5O) as one component in dual SMAD inhibition of pluripotent stem cells to differentiate into neurons alongwith SB431542. Now as to solubilizing 10mg SB in DMSO for...

11 July 2024 4,832 0 View

To prepare polymethyl methacrylate polymer for the study of acoustic properties without of bubbles during this process, what measures should be taken?

To prepare polymethyl methacrylate polymer for the study of acoustic properties, a mixture of methyl methacrylate monomer and benzoyl peroxide is used. This mixture is then heated and placed on a...

27 June 2024 2,087 1 View

Nicotiana benthamiana seeds sterilization methods for tissue culturing?

I have been trying to grow Nicotiana benthamiana via tissue culture. I used ethanol and sodium hypochlorite with different concentrations and time duration for seeds sterilization and lastly...

18 June 2024 1,756 3 View

As a university teacher, devise effective teaching methods to enhance students' presentation skills?

ABSTRACT The study explored the relationship between mindfulness levels and academic performance among prospective teachers in the subject of Technical Writing and Presentation Skills at the...

14 June 2024 2,867 2 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,777 1 View

Smart spectacles for paralysis people using the eye blink sensor it will detect the blink and provide what they need?

a man was facing a paralysis problem.. he wants some drink or else food not even he ask, because he paralyzed .while he put the smart spectacles he blinks the eyes it will count the sensors and...

13 July 2024 8,021 1 View

Nutrition map: What does it mean for you?

Unluckily, just similar to an expensive car, your brain can be damaged if you ingest anything other than premium fuel.

23 June 2024 2,287 7 View

Cortical Brain-Computer Interfaces: Thought Control, Movement Control, or Both Control?

“Several recent studies have shown the feasibility of decoding or synthesis [of] sentences of non-tonal languages, such as English (2-10) and Japanese (11), using intracranial neural recordings,...

01 June 2024 8,530 0 View

How does Post-Intensive Care Syndrome (PICS) impact the lives of ICU survivors in the long term?

Navigating the Post-ICU Journey: A Holistic Approach to Reco... How does Post-Intensive Care Syndrome (PICS) impact the lives of ICU survivors in the long term?

25 May 2024 4,161 1 View

PCOS ovarian morphology in hypohypo patient compaired to PCOS patients?

the ultrasonic difference of the ovarian morphology in PCOS, and Hypogonadotrophic hypogonadism oligomenorrhic patient and PCO ovarian morphology

22 April 2024 8,821 1 View

Is there any Non pharmacological intervention for treatment resistant schizophrenia using PANSS (RCT) please?

Is there any Randomised Control Trial (RCT) about ECT for treatment resistant schizophrenia using Positive and Negative syndrome Scale (PANSS) please? Is there any RCT about the use Cognitive...

30 March 2024 3,562 0 View

What is sepsis, and how does it differ from systemic inflammatory response syndrome (SIRS)?

27 March 2024 6,928 1 View

Where can I find current data on the disease "Gulf War Syndrome - Desert Fever"?

Dear researchers. I am a war veteran of the Persian Gulf War - "Desert Storm" and "Desert Shield" and I am looking for current data on the disease "Gulf War Syndrome - Desert Fever" for my...

15 February 2024 7,489 0 View

What is the correlation between metabolic syndrome and pulp calcification ?

Based on raadiographic assessment of the pulp chamber

03 February 2024 9,533 1 View

What are the considerations underlying the choice of rat as an animal model of metabolic syndrome compared to mice?

I study diabetic tendinopathy and would like to know the reasons for choosing rat animal models over mice when it comes to metabolic syndrome. Your help and discussions are very valuable to me....

02 February 2024 1,839 3 View