You may need to sequence your PCR reverse primer. Perhaps these nucleotides were omitted somehow during the design or synthesis of the oligo. Another possibility is that depending on your cloning strategy, you may be inadvertently deleting these nucleotides during your workflow. Maybe you introduced a restriction enzyme site accidentally within your oligo? Can you post some more information about your cloning strategy and the sequence of your oligo?

From the details you have have provided I cannot tell, did you clone your amplicon into an expression vector? Can you prevent expression of your cloned insert. It might be that E. coli cannot express you cloned insert or cannot express it at the levels driven by your vector....in that case mutations could be driven by the recombinants. |Alternatively, a mistake in the sequence may have been incorporated in your oligo at the time of synthesis. Oligos are reasonably cheap, order your 3' oligo again and re-amplify.

Hello Veera,

have you carefully checked whether there was another restriction site (before those 7 nucleotides) for the restriction enzyme you used before ligation? Maybe your RE cuts before the end of a gene, so you eventually get shorter gene ligated in the vector...

Have you used RE that cleaves at the recognition site or several bases farther?

I suppose you've checked the reaction mixture after control digestion on a gel and everything looked like you've expected?

I would also suspect the restriction digest. Check for other restriction sites which work with your enzyme and lead to a shorter product.

Hi guys,

thanks for your replies.

The cloning strategy that is involved here is a directional blunt end cloning via a gateway cloning strategy. The system I use is pENTR D TOPO (Invitrogen)

My forward primer has a CACC seq which is recognized by Topoisomerase and the other end (Reverse primer is a blunt end -since I amplify it with Pfu polymerase)

Hence I dont use any restriction site to clone in my gene of interest. However to check the positive clones I use two different restriction enzymes aprox 150by upstream and downstream respectively from the cloning sites. So I dont think its the problem of any restriction sites.

The sequence of the Reverse primer is

TTACTCAGCCCCGCCCTGCTCAGC (5'--->3')

The last 7 nucleotides TTACTCA is missing in my sequencing results

Hello Heather,

I havent expressed it in the cells yet. Since the sequencing failed and I cant see a stop codon, it didnt made any sense to me to go further. I was thinking about re ordering the reverse primer again as u suggested.

I've cloned into pENTR-DTOPO dozens and dozens of times and never encountered this phenomenon. Is any of your vector showing deleted sequence also? If not, then I'd suspect your reverse oligo was incorrectly synthesized or has degraded.

Try ordering a new reverse oligo.

Hi Daniel,

Thanks for your kind feedback. I have been doing this since last 6 months and i ve many constructs that were positive, this was the first time I encountered such a problem and not the vector dont show any deleted sequence. Your suggestions make sense, I never thought in that direction :) I will try to order new oligos and repeat it.

Thanks a lot

Have a great day.

We bad the same problem this summer ! Few bases and a stop codon desapering from the pENTR construct after topo cloning, some clone had the stop with few bases laking before... But we just made two more round of topo cloning and after more than 15 clones sequenced, finally, we had the good one. Just keep hope, make a new topo . ..

Hope is a great word. Thanks for sharing your experience Anne