Newton's second law

More Vasiliy Knyshev's questions See All

Non degenerate function and series Fourier?

1. Определение. Существует известная теорема, представляющая интервал в виде конечной или счетной суммы попарно непересекающихся интервалов. Сумма длин этих смежных интервалов равна длине...

08 June 2024 8,620 4 View

Is it possible to use dummy atoms in generalized internal coordinates (GICs) in Gaussian?

I found out that there is a great function for making scans in Gaussian - GIC. Unfortunately, I ran into a problem - the inability to add dummy atoms to the input file. In several questions on...

15 November 2020 1,164 2 View

What is the technique for precise determination of carbon phase composition by analyzing Raman spectra?

In MRS Communications, Volume 8, Issue 3, pp. 1343-1351 (2018) one can read: 'The peak fitting of the Raman spectrumusing the Gaussian distribution function gives the percentage of sp3 carbon of...

24 September 2020 5,554 5 View

Newton's Second Law of the third order?

The function assumes a direct and reverse law. What do we know about the inverse function? Never mind. This is just the shadow of the direct function. Why don't we use the inverse function, as...

03 November 2018 4,585 49 View

What is "latency to find the platform" in Morris water maze test?

Sometimes mice find a platform, but ignore it and continue to swim or immediately jump off. I thought, can this be seen as a manifestation of learning? That in this case to consider latent time...

17 March 2018 8,827 2 View

Can I use the Morris water maze test for assessment short-term spatial memory?

Morris water maze usually used for assessment long-term spatial memory during acquisition trial (Usually it is 24 hours or more after training). Can I use the Morris water maze test for...

09 March 2018 4,838 6 View

Is there any difference between Cathodic Arc Evaporation and Cathodic Arc Ion Plating techniques?

for deposition of hard coatings

08 April 2016 6,486 2 View

What went wrong in my equilibrating polymer melts via Molecular Dynamics?

I am wanting to simulate polymer melts. I created the initial files using the chain.f tool built in Lammps, and running the simulation protocol from the paper attached. When equilibrated my melt...

23 September 2014 4,864 6 View

Is gravity an EMERGENT phenomenon?

Newton found the law of gravity - but did not understand it. Fatio understood the law - but he was not accepted. Fatio assumed fast particles moving in all directions. Stability in planetary...

30 June 2024 9,284 28 View

Why exon number change by zooming out in Genome Browser?

Why does the number of exons of PTPRQ change by zooming out in Genome Browser site? the NM number is: NM_001145026.2

21 April 2024 8,336 1 View

No matches result in silico PCR at Genome Browser webpage!?

I want to check my designed primers by in silico PCR in Genome Browser. but always face with this message [ No matches to cagatgagtcagtgccgttag agtaggtgctgactggttcc in Human Feb. 2009...

06 April 2024 3,951 4 View

how to minimise the heat effect on 2 micrometer hole drilled by femtosecond laser on SU8 photoresist ?

If we have to drill a Hole on su8 photoresist layer with 2 micrometer hole depth and 2 micrometer in Diameter by Femtosecond laser drilling just near to another hole so newtons rings will be...

01 February 2024 5,393 1 View

Can't generalized Newtons 2nd law explain inertia mass change to comply with constant of speed of light?

While Newtons 2nd law cannot predict the constancy or upper limit of speed of light, c, its generalized version i.e.changing mass with constant acceleration definition can do. In other words,...

28 January 2024 9,464 4 View

How do I advance to Docking parameters using HADDOCK?

I entered 3 molecules in the Input data tab to carry out Protein-DNA interactions (protein, chain C; DNA, chain K; DNA, chain L). In the input parameters, I entered the active residues of the...

24 January 2024 3,750 0 View

Technical problem - NanoBrook 90Plus PALS (Count Rate too low)?

As part of my master's internship, I am going to be using the NanoBrook 90Plus PALS apparatus, which we have in the lab. Unfortunately, it suddenly started giving us some troubles when trying to...

16 January 2024 7,168 1 View

Are there any non-relativist, non observer effect ideas to reconcile Newton's laws with constancy of speed of light ?

In classical mechanics, an important principle is the principle of relativity: the physical laws are invariant with respect to the transformation from one inertial frame into another. Maxwell's...

15 January 2024 4,269 7 View

Social nature inspired teaching has a place in physics didactics?

It is a fact that most physicists have something akin to an allergy to to anything social in nature. Oxymoron is that (Keep in mind) science is and progresses via social enterprise i.e...

05 January 2024 3,705 1 View

What do the scientist do to avoid the application of the neutrino bomb?

Neutrinos are the freeest partikels in the universe. One can barely say, where they come from and where the go to. But impinging on matter without remarkable absorption they take with them...

22 December 2023 6,490 0 View

Ioseph Gurwich

The standard way today is:

From the "Principle of the least action" (See, e.g., Landau, "The classical mechanics")

Vasiliy Knyshev

Please look at my work: On the proof of Newton's second law. The poof of Landau I know.

I know two proofs of Newton's second law. The first is based on the principle of possible displacements and the second, Mexico, on the law of entropy. But there is no purely mathematical proof.