What aspect of qPCR do you want to optimize?

Could you please show us more information? The we can figure out it.

Bustin have write an article about that. I do not have the ref with me but it's about MIQE guidelinesin 2009. Maybe you could find some informations for your pcr.

But I agree, we need more informations to answer your question.

Dear All,

I hope everyone is doing good.

I got 2 sets of primers and probes for a duplex PCR to screen for CamVP35 promoter region and Nos Terminator region detection. (I attached an excel sheet-list of primers and probes) and mentioned below

5’ FAM-CAAAGATGGACCCCCACCCACG- BHQ1 3’----P35 probe

5’ HEX-ATGGGTTTTTATGATTAGAGTCCCGCAA-BHQ1 3’ ----Nos probe

5’ GCCTCTGCCGACAGTGGT 3’------P35 Forward primer

5’ AAGACGTGGTTGGAACGTCTTC 3’------P35 Reverse primer

5’ CATGTAATGCATGACGTTATTTATG 3’------Nos Forward primer

5’ TTGTTTTCTATCGCGTATTAAATGT 3’------Nos Reverse primer

Both the probes were HPLC purified and primer sets were desalted.

I request you to look at the list.

When I received these oligos and probes. I made 100microM stocks with 1X TE solution. Primers are OK but two probe solutions are in dark ash color ( I thought BHQ1 might be the reason).

I did the standard curve experiment as per an ISO method (the sequences were published in ISO: 21569 recent edition) for this system with known gDNA standards. I fell sick seeing the data... there is no reaction crossed the baseline (actually while monitoring the run the fluorescence was in -0.04 level and did not touch the 0 at all).

I checked the PCR products (for P35 it is 84 and for Nos it is 82bp) on 4% agarose gel. all the reactions with known standards gave a clear specific amplification with a little primer dimer at bottom. NTC gave nothing. I did one more qPCR with them following kit recommendations (Promega A6102). Using 900nM primers and 250nM probes (gave no result)

Thought to put a simplex PCR separately for two detection systems. Even then I dint see positive fluorescence. I observed Nos detection system with HEX (-0.1) gave lesser fluorescence than FAM (-0.04).

I am sure about few things that

1). gDNA standard I've used is perfectly alright (giving positive amplification with routine PCR and its quantification data shows that it is good with purity and quantity)

2). Next is primer sets I ordered and used are working (+ve size with STD and no band in NTC on gel).

3). Water I used is nuclease free water provided along with promega kit.

4). My equipment is working fine (thermal cycling is OK proved my gel, but optical detection system was calibrated by factory for dyes Cy5, FAM, Green, Hex, ROX, VIC )

I did not understand the problem, whether the qPCR probe mastermix is not performing 5’ exonuclease activity for probes (it is giving amplicons of desired size after cycling-proved by gel). Or The probes that I ordered are not good (I reconstituted them as per one document of ABI-life tech, using 1X TE solution to dissolve and 1X TE to dilute for both probes and primers avoided exposure to light by wrapping tubes with reflecting foil).

As a newer to this technique, I am totally confused how to proceed and overcome if there is problem within the protocol.

Dear all I am requesting your help in solving my problem. Kindly do this favor.

Thank so much,

Kits of which company is accurate for QF PCR?

Chromoquant 513 version and anufast QF-PCR are the best commertial kits for the number of informative STRs which they used in the kit.

Thanks