Ask for help about wannier90, hopping matrix elements are not complex conjugate?

Dear All, I calculate band structure and hopping matrix of monolayer Graphene by using wannier90-2.0.1. There are two atoms in one unit cell, the following is input information : INCAR :...

26 February 2020 4,885 1 View

How to calibrate a T/C CO2 sensor in an air-jacketed CO2 incubator without an independent CO2 sensor?

I have an air-jacketed CO2 incubator and I need to calibrate its thermal conductivity CO2 sensor. However, I do not have a CO2 sensor that is independent of the incubator to measure the CO2...

31 January 2020 8,758 1 View

What is a good procedure to identify if the CO2 incubator is the source of contamination in my cell cultures?

I have read some vague descriptions about how to screen the CO2 incubator as the source of contamination. I saw recommendations to leave a plate of cell culture media in the incubator and view it...

12 January 2020 8,639 2 View

Have problems in insert sgRNA into lenticrispr v2 vector?

my oligo forward: 5`->3`:CACCGCTAGACACGGAATCATGCCG reverse 5`->3`:AAACCGGCATGATTCCGTGTCTAGC I done all things stickily followed the zhanglab protocol-Target Guide Sequence Cloning Protocol,...

28 December 2018 4,592 3 View

How to measure the perceived contradiction of "need certain resource yet cannot acquire it"?

How to measure the perceived contradiction of "need certain resource yet cannot acquire it"?

28 March 2018 6,378 2 View

Can I run a multiple regression with 150 cases altogether with hormones as independent variables to predict birth weight?

12 October 2016 6,081 4 View

What is the proper stimulation point (dosage and time) for VSMC proliferation?

20 February 2015 2,729 1 View

How do you distinguish between human and mouse cells in mouse sections?

Does anyone know good antibodies to distinguish between human epithelial cell and mouse cells in mouse liver sections by IHC staining? Thank you for your answers.

16 November 2014 4,670 3 View

Do you starve PBMCs before LPS stimulation?

I'm maintaining mouse PBMCs in 10% FBS for a LPS stimulation experiment. I'm going to plate the cells in 96-well plate and treat them with LPS for ELISA. Just wonder if you guys starve the cells...

07 November 2014 9,702 5 View

Why is there so much discrepancy between the lanes when using the BCA method determine to protein concentration?

23 September 2014 3,838 7 View

What is the best way to keep an anaerobic chamber anoxic in the absence of hydrogen?

I'm a graduate student who works with an anaerobe, so I often work in an anaerobic chamber. I've been working on an assay that involves the steady-state of the quinone/ quinol pool. Anoxic...

03 March 2021 2,971 1 View

How to model Supercritical water gasification (SCWG) process in Homer software?

Hi everyone How to model Supercritical water gasification (SCWG) process in Homer software?

25 February 2021 4,075 1 View

Is it possible to define biogas as a fuel in the reformer process(scwg) in Homer software?

Hi every one Is it possible to define biogas as a fuel in the reformer process(scwg) in Homer software? Biogas fuel is not available in the options thanks

23 February 2021 6,518 3 View

How the standard hydrogen electrode value is convertible into reversible hydrogen electrode?

As much I remember +0.0592*pH, as I am working on CatMAP, so my voltage values are in SHE, not RHE.

18 February 2021 1,685 3 View

Can explain this diagram to me, is this the average consumption curve for one day or the total consumption of days in a month summed up in specific?

The hourly load curves of the selected household in each season are shown in Fig. 28. Figure 28 shows the demand for electricity in four months on an hourly basis. Can you explain this diagram to...

08 February 2021 657 16 View

How define one baker unit(BU) is the amount of hydrogen peroxide catalase ?

07 February 2021 2,006 1 View

Which one is better for storing energy: Fuels synthesized from CO2 or Hydrogen?

Based on educated guesses, which one of the following promises a better future for storing energy for grid scale, automobiles etc as opposed to batteries: 1) Fuels synthesized form CO2 2)...

02 February 2021 8,741 6 View

Why is WST-1 assay giving inconsistent result?

i want to determine the cytotoxicity activities of some drugs with WST-1 assay using 293T cell lines in 96 well plate. I usually seed 10,000 cell per well and incubate for ~48 hours. I expected...

01 February 2021 8,554 3 View

How to perform hydrogen underpotential in hydrophobic material?

I have a working electrode composed of deposited graphene material (confirmed from Raman).The graphene is porous and has deposited Pd nanoparticles. I am trying to perform hydrogen underpotential...

01 February 2021 3,199 1 View

How do you prevent excessive foaming of organic-matter-rich soils during H2O2 digestion?

My samples are very high in organic matter, and even small amounts of H2O2 cause the samples to foam up 4-5 times the beaker volume, spilling onto the lab bench. Is there anything that can be done...

17 January 2021 8,784 3 View