Is Oxonol VI a slow-response or fast-response potential-sensitive probe?

05 August 2025 1 2K Report

I need to determine whether Oxonol VI is a slow-response or fast-response potential-sensitive probe in order to establish the appropriate experimental conditions and detection methods for my study.

Lily Watson

Chloe Sun Hi, Chloe, Oxonol VI is a slow-response potential-sensitive probes and slow-response membrane potential probes exhibit voltage-dependent changes in transmembrane distribution, accompanied by fluorescence variations. Their optical response magnitude is significantly larger than that of fast-response probes.

The answer to this question comes from MCE Technical Support.

[email protected]

Badges
Science topic

Similar topics
Mathematics
Statistics

More Chloe Sun's questions See All

Is there an English Translation of the Carl Moller text: ZUR VERGLEICHENDEN ANATOMIE DER SILURIDEN?

I recently came across an anatomy text by Carl Moller that was published in 1915 but it is in German or Dutch neither of which I can understand. I would like to know if there is an English...

10 August 2024 4,347 1 View

Why results of ROS flurescence are negative as there was no bacteria within?

Hello. I am working on ROS production of two systems: system A is cerium oxide and hydrogen peroxide, system B is cerium oxide nanoparticle, hydrogen peroxide and potassium bromide. I did some...

04 August 2024 5,974 3 View

How to add Cr parameter in autodock?

When I run autogrid4 it says: autogrid4: ERROR: Unknown receptor type: "Cr" -- Add parameters for it to the parameter library first! Look forward to your reply.Thank you so much!

29 July 2024 488 0 View

What publications should I target as a psychology masters student in the UK?

I am writing a paper as a part of my course. I am new in London and was wondering that what publications should look upto?

21 July 2024 3,538 1 View

I have two problems: 1) the enzyme is not immobilizing efficiently into the MOF material.. 2) the MOF itself has peak on 400nm by using p-NPA test.?

I am working on carbonic anhydrase immobilization into MOFs. I am facing problems with low enzyme loading.. The other issue is that when using p-NPA activity test to detect the activity of the...

20 July 2024 1,440 3 View

What analysis to use for an dependent variable with repeated measures and a independent variable only measured once?

Hi all, I am trying to use mixed effect model to analyze my data, which including a baseline measurement for my exposure (A), and repeated measurements for the outcome (B). I do have some...

17 July 2024 8,682 3 View

I need to know the required time for VDF heating with water for 50-80°C for PVDF Polymerization in ?

i need to know the required time

15 July 2024 4,796 2 View

What analyzes do you use to compare biodiversity in a square, at two different times?

e.g. moment one: square in its normal state moment two: square after cutting large trees and replacing them with dwarf trees.

12 July 2024 8,258 5 View

Which software use to i make this graph quickly and also make more dimensions of this graph( i mean adding vertices or lines in this graph)?

Anyone kindly tell the name of software that make this graph quickly and also tell how we add vertices or lines in this graph with equal distance to get next dimensions of this graph ( i mean how...

11 July 2024 4,499 2 View

Authorship for data analysis?

I participated in 2 research projects in which I was responsible for part of data analysis and figures production. Also, I spent hours trying a new statistical approach -for me- to implement in...

10 July 2024 1,226 5 View

Z-average size from Dynamic Light scattering can it be lower than the original probe size?

Hi everyone, Recently I have been conducting Dynamic Light scattering experiments in a micellar solution at 5 and gel at 37 degrees of Celsius with latex particles of diameter 190-500 nm. While...

01 August 2024 1,168 4 View

How to build my own lab made four point probe set up?

Hello, I'm trying to measure the conductivity of semiconductor films but since I don't have a commercial four point probe set up I would like to build one on my own in my lab. I have generators,...

30 July 2024 906 2 View

Is it necessary to attach fluorophore at 3' end in MIC RT PCR machine for Dual hybridization Probe designed especially for genotyping assay?

I designed 2 dual hybridization probes for my single SNP. where I attach my fluorophore 5'-FAM-nnnn-BHQ1-3', and 5'-HEX-nnnnnn-BHQ2-3'. I need to run it on the MIC RT PCR machine by Biomolecular...

28 July 2024 5,658 0 View

Chromosomal spreads are shrunken after fluorescence in situ hybridization (FISH), why?

Dear colleagues, We are trying to do FISH on mice PDEC metaphase spreads. We use homemade biotin labelled probes, synthetized using a nick translation kit. For hybridization, initially we were...

08 July 2024 8,687 3 View

Can I design a probe for taqman qpcr in antisense?

I have a target of sequences for primer design for qPCR with taqman. The issue is that when I design a sense probe the probe makes dimers with forward and reverse with a very high probability at...

16 June 2024 1,506 1 View

Problems with designing syber-green primers for lnc_RNA GAS5?

Hi all, you know this lncRNA has 12 exons and 50 isoforms that just have similar sequences in exon 12. Coud someone recommend me primers for this exon with no need of probes?

15 June 2024 8,055 0 View

Can holes for pressure probes in journal bearings modify the original pressure distribution?

It is very common to measure the pressure distribution inside the bearings with pressure probes connected to the oil film through holes in the bush. Once filled and pressurized, the probe lines...

12 June 2024 1,936 0 View

Why am I having huge shifts in reference genes Cq's?

I was recently performing a great deal of qPCRs on adipose tissue derived RNA. I had experimental samples from sick, and control samples from healthy individuals. I used the same chemistry for all...

04 June 2024 6,924 0 View

How can I check the primer and probe on NCBI?

this primer and probe are specific to the mthfr gene (C677T) AGGCCAGCCTCTCCTGACTG AGGACGGTGCGGTGAGAGTG Taq man probe: CGGGAGCCGATTTCATCA—FL 640-CGCAGCTTTTCTTTGAGGCTGACA—PH

03 June 2024 239 2 View

Amine-reactive probe that absorbs light > 600 nm?

Hi, I am looking for some low molecular weight organic compound/dye that absorbs light above 600 nm up to 750 nm with a decent absorptivity, that is reactive to amines or has a carboxilic acid...

22 May 2024 2,803 5 View