Is equity financing the best strategy in volatile business environments for long term investments?

More Ümit Hacıoğlu's questions See All

How to design a primer for identification?

Hello! I need to identify some microorganisms we isolate from nature. The company we have an agreement says that I need to design a primer as fw primer: 5′ ACACTCTTTCCCTACACGACGCTCTTCCGATCT –...

21 June 2021 8,395 2 View

Is it important to Cas9 activity 1 or 2 mismatch for designed gRNA?

Hi everyone, We designed gRNA with a maximum lenght of 20 nucleotide and I check my gRNA with Human Genom Browser/Blat web tools no matches found. However I use CCTop web tools (...

22 January 2020 2,399 0 View

Does transfection efficiency increase in the basal transformed HaCaT (Human Keratinocyte) cell line?

We know that transfection forcing us in the HaCaT cell lines. I use different transfection agent PEI or Lipo. But I wonder if I use Basal HaCaT cell line ı could change transfection...

17 October 2019 2,624 1 View

In a responsive evaluation, I wonder if the term of responsive mean that answer (response) or sensitive (responsive)? Which one and why?

In R. Stake's responsive evaluation, I wonder if the term of responsive mean that answer (response) or sensitive (responsive)? Which one and why? And Stake emphasized that for other evaluation...

27 December 2013 2,163 3 View

What are the strengths and limitations of the UCLA evaluation model?

I need an extraordinary answer for this question!

14 December 2013 4,649 0 View

Raw Material Problem for preparation of oil emulsions with Low Molecular Weight Chitosan From Sigma

Hello, I am having trouble with a new box of LMW Chitosan which I purchased from Sigma-Aldrich. The old box that I used before, was product of Iceland, and the new one is the product of U.S., both...

01 January 1970 1,880 2 View

Research Methodology - Impact of Corporate Reputation on Stakeholders Behaviors?

Please can anyone support with the survey questions based on RQ measures and propose how to do it in FMCG industry and include as well the role of brand equity Thanks

06 August 2024 949 0 View

E-commerce businesses, COVID-19 and Entrepreneurial Strategies (innovation, proactiveness and risk-taking)?

Hello: I am looking for articles that address e-commerce businesses and COVID-19 survivors, as well as Entrepreneurial strategies that reflect e-commerce businesses. Blessings Evelyn Dempsey

05 August 2024 5,332 3 View

Determining the worth of a point improvement in Hamilton Depression Scale?

Dear readers, Thanks for your attention. I am wondering about the health economic problem of quantifying the value of interventions which a) prevent, b) improve symptom profile and c) ultimately...

05 August 2024 3,246 1 View

What should Berlin do as a city to become as impactful as London and Paris in World Football?

Please go through my Abstract. I can also share a proposed Thesis Outline.

04 August 2024 2,077 0 View

Identify the eight key processes of excellent supply chain management and discuss how each of these processes impacts the end customer?

Read the journal article by Douglas M. Lambert, “The Eight Essential Supply Chain Management Processes,” Supply Chain Management Review, Vol. 8, No. 6 (2004), pp. 18-26

04 August 2024 9,919 4 View

Do we save MSMEs of the Nation ?

SMEs are backbone of the country's white economy, most of them are II generation entrepreneurs and migrated from family owned business policies, and having sufficient higher educations for...

01 August 2024 5,562 2 View

What are the most effective strategies for integrating sustainability in your expertise?

What challenges do you think businesses or entities face in implementing these strategies? Thanks

28 July 2024 2,125 14 View

Patronage margin difference between offline womens'apparel store and its equivalent online.Is this a good research topic?

I intend to explore and assess how offline womens' modern apparel store are losing out online and the need to get them on board based on this assessment. I am on a student on MPHIL Media and...

26 July 2024 1,440 1 View

Corporate Social responsibility strategy?

strategy and organisation of effective social responsibility in corporations

24 July 2024 5,003 2 View

Has the Affordable Connectivity Program Helped You/Your Community? And Would Bulk Tablets on a Similar Program Help Your Business?

Do You Believe VP Harris Would Show Empathy to Tech Companies in Her Administration as POTUS? I ask in light of the fact that, the ACP was not re-funded this round. So many and businesses need...

24 July 2024 4,732 3 View

Utkarsh Goel

Its traditional knowledge that equity financing is better for volatile business. The reason behind it that equity is permanent in comparison to debt which needs to be return after a fixed period. Thus even if situations are bad u dont have to return money in case of equity but have to so in case of debt. But the Debt financing is cheaper and thus help in reducing some extent of volatility and reduce risk

Patrick Navatte

Hi Umit,

Suppose that you have the opportunity to finance a very very long term project with a perpetuity. I mean a bond on which you pay only a coupon but that will never be reimbursed... What difference with equity if the coupon rate is equal to the dividend rate and if no one intends to get his/her money back !!!