I don't know if this could be useful for you but I use daily "homemade" long dsRNA for in vivo knockdown and these RNAs are synthetized with T7 in vitro transcription. We use a pCR2.1 and the TOPO TA kit (Invitrogen) combined with TOP10 bugs for cloning the desired target fragment, if everything's ok this take from primers resuspension to invitro transcription around 5-6 working days (sequencing included). 

We don't use directly the plasmid for the Ambion T7 MEGAScript in vitro transcription but the kit is also suitable for the transcription directly from linearized plasmids with T7 promoter as a feature or even, what we do, from a PCR product amplified from the plasmid of interest.

We amplify the target fragment via PCR with T7 primers and we use the PCR for the further RNA synthesis. In this manner you'll have a super efficient PCR from a plasmid plus a reliable and stable source for the transcription. The kit works really well, we're able to obtain 1mg of dsRNA from a 80ul single reaction.

If you need only the sense RNA you don't need to do anything more than digest the pCR2.1 plasmid with the fragment cloned inside in the proper direction and use the linearized vector directly for MEGA Script reaction. T7 promoter is already present into this plasmid.

On the other side if you need both the RNA strand (if you need a dsRNA) you should insert the T7 promoter downstream of your desired sequence.

Hi Hanh, 

if I understand well your question, the procedure should be quite straightforward.

First, if you don't have it already, you must clone the sRNA coding sequence into a suitable plasmid, that is any containing the T7 RNA polymerase binding site.

this is all you need to have a gene  transcribed very specifically by T7 RNA pol:

5' TAATACGACTCACTATAGGG 3'

you can also design a primer containing the T7 site followed by your sequence of interest. 

You do not need a START codon as long as you are interested in producing just an RNA species (because it is your functional molecule or because you want to use it as a single strand probe), otherwise, if you are going to do in vitro transcription & translation you WILL need start and stop codons!

no need for polyA site as this is a phagic RNA pol.

I advise you to linearize the construct downstream of your sequence of interest (by using any restriction site that will not cut into your insert) before T7 transcription, as this will increase efficiency of transcription by providing a natural end to it.

Good luck!

Paola

in alternative to cutting the plasmid, if you want to do a "cleaner" work, you can clone a T7 Terminator: GCTAGTTATTGCTCAGCGG downstream of your seq of interest. Don't forget to design a negative control (a sequence, surrounded by the same T7 seqs, that will not bind your protein of interest) and possibly a positive control. P

Hi Paola,

Thank you very much for your kindly response. I am wondering if I really need to do a cloning to a vector or do a PCR and introduce T7 promoter and terminator to the pcr product that should be  enough.

Thanks,

Hanh

hi again, Hanh,

yes, you can just use the PCR product!  

I don't know if this could be useful for you but I use daily "homemade" long dsRNA for in vivo knockdown and these RNAs are synthetized with T7 in vitro transcription. We use a pCR2.1 and the TOPO TA kit (Invitrogen) combined with TOP10 bugs for cloning the desired target fragment, if everything's ok this take from primers resuspension to invitro transcription around 5-6 working days (sequencing included). 

We don't use directly the plasmid for the Ambion T7 MEGAScript in vitro transcription but the kit is also suitable for the transcription directly from linearized plasmids with T7 promoter as a feature or even, what we do, from a PCR product amplified from the plasmid of interest.

We amplify the target fragment via PCR with T7 primers and we use the PCR for the further RNA synthesis. In this manner you'll have a super efficient PCR from a plasmid plus a reliable and stable source for the transcription. The kit works really well, we're able to obtain 1mg of dsRNA from a 80ul single reaction.

If you need only the sense RNA you don't need to do anything more than digest the pCR2.1 plasmid with the fragment cloned inside in the proper direction and use the linearized vector directly for MEGA Script reaction. T7 promoter is already present into this plasmid.

On the other side if you need both the RNA strand (if you need a dsRNA) you should insert the T7 promoter downstream of your desired sequence.