rtrp@rtrp-Inspiron-3420:/media/New Volume/Vel/mirdeep2$ perl mapper.pl config.txt -c -d -i -j -k TGGAATTCTCGGGTGCCAAGG -l 18 -m -p rn5.index -s reads.fa -t reads_vs_genome.arf -v

handling file 'H9A2M.fasta' with prefix 'A2M'

converting rna to dna alphabet

sh: 1: rna2dna.pl: not found

discarding sequences with non-canonical letters

clipping 3' adapters

sh: 1: clip_adapters.pl: not found

discarding short reads

collapsing reads

sh: 1: collapse_reads_md.pl: not found

mapping reads to genome index

More Velmurugan Ganesan's questions See All
Similar questions and discussions