How to precipitate dipeptide?

Velmurugan Shanmugham @Velmurugan-Shanmugham

12 June 2024 0 400 Report

Hello

I have synthesized a dipeptide in an aqueous media.

Now I want to precipitate and filter it.

How to precipitate it.

Thank you in advance.

Velmurugan S

Badges
Science topic

Similar topics
Methodology
Laboratory

More Velmurugan Shanmugham's questions See All

How do overcome the shortcoming of tetrahedral element while solving problems using FEM?

I am using this element in FEA. If we solve the problem in FEM what are the possible solutions

05 September 2018 3,984 3 View

Is there any tool to predict target mRNAs for novel miRNAs?

After analyzing NGS data, we identified a few novel miRNAs. Now the next task is to identify the target genes of these novel candidates but most of the miRNA target prediction tools identify...

08 September 2013 6,325 9 View

In miRDeep2, the multithreaded perl scripts are showing not found, though they are in the same folder.

rtrp@rtrp-Inspiron-3420:/media/New Volume/Vel/mirdeep2$ perl mapper.pl config.txt -c -d -i -j -k TGGAATTCTCGGGTGCCAAGG -l 18 -m -p rn5.index -s reads.fa -t reads_vs_genome.arf -v handling file...

08 June 2013 1,623 2 View

What are the values needed for gabor filter's parameter for cifar10 data?

Hi, I implemented a code to gabor filter cifar10 data but the images after being filtered and stacked are not clear like the original images. I think the problem is in the way I am using the...

03 March 2021 6,317 1 View

How to calculate Total Flavonoid?

I analyzed flavonoid total spectrophotometry, the procedure as below: 2 ml supernatan added 5 ml dd.H2O, then added 0,15 ml NaNO2 5%, 5 minutes later added 0,15 ml AlCl3 10%, After 6 minutes,...

01 March 2021 6,722 1 View

Precipitate after adding laemmli buffer to protein solution containing Potassium Acetate?

Hi, I am running a size exclusion chromatography experiment with a buffer containing Potassium Acetate as a salt. I analyse these fractions through SDS-PAGE. After boiling my SEC fractions in...

01 March 2021 2,622 3 View

RNA-seq DEGs downstream analysis and reporting in literature?

I used EdgeR to get the list of DEGs (differentially expressed genes) from my liver RNA-seq experiment. I have done the gene overrepresentation and GSEA based pathway analysis. I am currently...

23 February 2021 8,969 1 View

What are the ranges of four diffterent poles of butterworth filter for ECG signal?

Hi, Can anyone please tell me what are the ranges of four different pole orders such as first order, second order, third order and fourth order respectively of butterworth filter for ECG...

23 February 2021 2,554 3 View

Which polarizers are usually used to measure the birefringence of zebrafish muscles?

I already found several publications on that topic, however, the specifications for the used filters are often missing. Some more specific information than "fish is placed between to polarizing...

23 February 2021 1,934 1 View

What low-cut filter (high Pass frequency) to be used for response spectrum (Tripartite plots) ?

What low-cut filter (high Pass frequency) to be used for the response spectrum (Tripartite plots)? I am currently working on differentiating between hard/soft site responses in Indo-Gangetic...

21 February 2021 9,273 2 View

Is it possible, for a limited dateset of images, to use Convolution filters + Random Forest instead of UNet?

UNet is 'relatively' recent and was invented mainly to deal with biomedical images, yet is it also possible, for a limited dateset of images, to use Convolution filters + Random Forest instead of...

21 February 2021 4,858 3 View

The type of filter paper used to filter an epoxidized oil (the mixture is an epoxidized oil with magnesium sulfate) ?

I have a mixture of epoxidized oil and magnesium sulfate wich type of filtre paper should i use

21 February 2021 3,944 3 View

Is the box plot of climatic indices better illustrate from daily data or annual data?

Hello, I hope you have a good time. I work on a research project about temperature indices. Due to the high number of indices, I only work on tables and maps on an annual time scale. In other...

19 February 2021 9,742 2 View