How to precipitate dipeptide?

Velmurugan Shanmugham @Velmurugan-Shanmugham

12 June 2024 0 531 Report

Hello

I have synthesized a dipeptide in an aqueous media.

Now I want to precipitate and filter it.

How to precipitate it.

Thank you in advance.

Velmurugan S

Badges
Science topic

Similar topics
Methodology
Laboratory

More Velmurugan Shanmugham's questions See All

What are the best free app for medical students?

My medical students are asking what are the relevant medical apps to learn more about the subjects.

21 December 2023 8,065 2 View

What are all the latest updates and future trends in the Additive Manufacturing technology with 3D Printing process?

I am verymuch intreasted in doing research in the field of the Additive Manufacturing technology with 3D printing process. Because of that i would like to know about the clear details of the...

26 February 2023 2,769 4 View

Can anyone suggest of how to have forecasting using ensemble machine learning model?

Python code for forecasting using ensemble model is needed to study.

18 May 2021 8,419 4 View

How do overcome the shortcoming of tetrahedral element while solving problems using FEM?

I am using this element in FEA. If we solve the problem in FEM what are the possible solutions

05 September 2018 4,156 3 View

Can anyone suggest me were can i buy live plastic eating wax worms in India or else in Tamilnadu?

I have a project on plastic eating wax worms, so i need to buy a set of worms to rear in my lab and examine its capacity of degrade plastic. so please i request anyone to suggest me were can i...

11 August 2018 2,549 2 View

How to use DDE-BIFTOOL for draw bifurcation diagram for delay differential equations? I am using MATLAB 2010. Any model program for using DDE-BIFTOOL?

For example, Bifurcation diagram for Delayed Lorenz system by using DDE-BIFTOOL?. Bifurcation parameter is taking as delay.

14 March 2016 3,832 12 View

Is it possible that fractional derivative can be defined by using backward/forward difference operators?

In addition, How can write Fractional Taylor's series?

31 May 2015 8,054 0 View

Is there any tool to predict target mRNAs for novel miRNAs?

After analyzing NGS data, we identified a few novel miRNAs. Now the next task is to identify the target genes of these novel candidates but most of the miRNA target prediction tools identify...

08 September 2013 6,380 9 View

In miRDeep2, the multithreaded perl scripts are showing not found, though they are in the same folder.

rtrp@rtrp-Inspiron-3420:/media/New Volume/Vel/mirdeep2$ perl mapper.pl config.txt -c -d -i -j -k TGGAATTCTCGGGTGCCAAGG -l 18 -m -p rn5.index -s reads.fa -t reads_vs_genome.arf -v handling file...

08 June 2013 1,682 2 View

Urine-Nitric Acid Digestion

Hello all, I am trying to detect the quantity of cadmium in urine samples. When I digest the urine with nitric acid as suggested in literature, I noticed precipitation of black particles and in...

09 March 2013 2,613 2 View

Is the black sediment consider as sand? If not, how can I filter it out?

Hi researchers! I'm working on soil texture analysis, and the end result for sand is doubtful because there is black sediment appearing after drying, as shown in the figure. Is it considered sand?...

30 July 2024 557 2 View

Can we isolate microplastic from sludge sample without using vacuum filter..?

isolation of microplastic from sludge sample using centrifugation ..

23 July 2024 6,418 0 View

In kalman filter, it is logical to have the observation variance equale 0 ?

I am working on implementing a Kalman filter integrated with ARMA parameters, as described in the article "Predicting Time Series Using an Automatic New Algorithm of the Kalman Filter"...

12 July 2024 8,116 2 View

How to wash capsule filters (Membrane: polyethersulfone; pore size0.2u/0.45u) after filtration. can I wash by NaOH? if yes, what will be the molarity?

11 July 2024 8,969 1 View

65% saturation of ammonium sulfate in 100 ml? (for protein precipitation)?

Hi All: I need to precipitate extracellular protein from supernatant. A bit confused with ammonium sulfate calculation. Should I be adding: 1. 65g of ammonium sulfate in 100 ml of...

09 July 2024 5,508 0 View

How to disperse silverparticles in water?

I synthesize silver nanoparticles ，and reserve it in water. Then, when I sonicate it some minutes or longer ,it couldn't be dispersed, most of them aggregate .Otherwise ,when I sonicate several...

09 July 2024 7,335 0 View

How to filter structural variants from WGS/WES data?

Hello everyone! I would appreciate some advice regarding the filtering of structural variants. The variant caller used for discovery-“DELLY or DELLY2”using whole-genome sequencing and Whole...

09 July 2024 498 1 View

How to filter/get the silver nanoparticles &nanoplates ? We synthesis this silver nanoparticles materials from the NaBh4, trisodium citrate,H2O2?

After finish the synthesis of nanoparticles.and nanoplates of silver how to take out those as solid/powder form from the solution. Please give a solution of u already done that and succeeded by that

27 June 2024 692 1 View

What is the appropriate filter size?

I have truck tire particles that I am using in my column experiment. I am trying to do size determination using the Malvern Zetasizer. My sample concentration is 0.1 mg/L, i.e., 10 g of sample was...

22 June 2024 8,857 6 View

Challenges in Stabilizing and Concentrating a Highly Unstable Acetyltransferase for Crystallization?

I am working on an acetyltransferase that is highly unstable. Its pI is 6.65, and its molecular weight is around 18 kDa. The protein elutes at 1M imidazole and begins to precipitate immediately...

19 June 2024 2,590 0 View