Hello! I'm conducting an endpoint RT-PCR, and I'm working with MDCK cells (a dog cell line).
I'm encountering multiple bands during amplification. I included a negative control (water) as the first band and a positive control (RNA obtained from dog WBC) as the second line, and there were no additional bands observed.
What could be the issue with my samples? Thanks.
Possibly you have genomic dna contamination and the primers are annealing elsewhere to produce extra bands in your test sample
Yes! i thinks thats an option, but i extracted both the positive control and the sample with the same kit and one gives a clean product and the other that many bands.
It might still be worth dnasing the rna or deliberately amplifying a genomic dna sample to see if that produces the same extra bands in case the kit allowed some dna contamination to come through with thr rna {possible sample overload)
Cite
Manoj Balakrishna Menon
Indian Institute of Technology Delhi
Are you working with one-step or two-step RT-PCR? If two steps, how much cDNA are u using in the final PCR reaction? The immortalized, hyperdiploid epithelial cell line may have multiple splice variants of the transcript, compared to primary blood cells.
Cite
Dylan E. Sendyk
Universidad de Buenos Aires
Hi!
It´s a two-step RT-PCR, we use 100ng of cDNA.
Cite
Similar questions and discussions
Two bands in PCR product?
Question
7 answers
- Jaishree Sankaranarayanan
I m getting two bands in PCR product! I adjusted the temperature and time in cycles. The first band is the actual band which is around 518bp the second is not the one. Thankyou
Why the band of the PCR become double?
Discussion
8 replies
- Hazirah Azizan
Hi, I have a question regarding my PCR products. Okay so i did some primer optimization for primer 1 using gradient temperature starting 55-60’C and i chose temperature 56.6’C as my temperature as it show a clear band. However, when i did amplification using primer 1 at 65.5’C for all my 60 samples, they showed double bands which are quite questionable as they did not even showed up when i did my optimization. Can someone help me to identify the problem? I did the same step with the same primer and the same machine. Here, i attached my result. For your information, 1e is the band for 56.6’C.
Why my PCR product is too short?
Question
3 answers
- Julia M.
Hi everyone,
I need your help with optimazing my PCR reaction. My PCR product should be 850bp. Starters Tm is 65, they do not form dimers or secondary structures and they’re specific (Blast doesn’t show any unspecific product that may occur). I've tried gradient PCR with typical mix and with Hot start polymerase and every time I receive strong band that is 150bp. What can I do to get rid of this unspecific product and what can it be?
How can electrophoresis results appear on the gel more clearly?
Question
5 answers
- Vo Hoai Hieu
After performing PCR, I ran electrophoresis, but on agarose the results showed some rather blurred samples. I wanted to know the cause and how to fix this situation. Please note that the chemicals and dyes are normal because the positive control shows a clear band.
My PCR product is showing smears, what are the possible causes?
Question
9 answers
- Nurin Jazlina
I ran a PCR reaction and it gave good result during the trial run. However, once I ran the same PCR reaction on all of the other samples, there are smears and appearance of non-specific bands. I'm not sure on what went wrong. Hopefully, I could get some insights to fix this issue. Thank you in advance!
Unable to digest insert amplified using NEB Q5 polymerase?
Question
6 answers
- Hemanathan Vembuli
I am currently cloning a gene of interest (460bp). I amplified my gene of interest using two polymerase 1) NEB Q5 polymerase enzyme 2) Taq polymerase. The forward primer has XHOI restriction site, and the reverse primer has NOTI restriction site. After amplification of my insert, I PCR purified the product and proceeded further to double digestion. For double digestion I used XHO1 and NOT1. After double digestion the product generated from Taq polymerase yielded digested product whereas double digestion of product yielded from Q5 polymerase seems like uncut. What will be the possible problem here. How to trouble shoot this?
Note: I have performed both sequential digestion and double digestion for Q5 polymerase generated amplicons.
Thanks, in advance.
Problems with designing ARMS-PCR primers?
Question
5 answers
- Thuy Nguyen
Hello everyone, I have some inquiries about my ARMS-PCR reaction. I have a mutation A19G (bolded nucleotide). GAACGCACGGACATCACCGTGAAGCACAAGCTGGGCGGGGGCCAGTACGGGGAGGTGTACGAGGGCGTGTGGAAGAAATACAGCCTGACGGTGGCCGTGAAGACCTTGAAGGTAGGCTGGGACTGCCGGGGGTGCCCAGGGTACGTGGGGCAAGGCGTCTGCTGGCATTAGGCGATGCATCTGCCTGGAAGTCTACCTCCTGCCTGCTGTCCGAGGGCTTCATTGGC
Wt-F: GAACGCACGGACCTCACCA
M-F: GAACGCACGGACCTCACCG
R: GCCAATGAAGCCCTCGGAC
I checked on SnapGene Viewer and got the following results: With Wt-F -R primer: no binding With M-F-R primer: binding However, in reality, the electrophoresis results show both primer pairs are paired (as in the image below). I would like an explanation for this result and advice on designing primers for my reaction. Thank you.
What is the reason for the lack of DNA bands in gel electrophoresis?
Question
3 answers
- Jasmine Sherbakov
I was running PCR 2 lines of fax1 potential mutation (with positive and negative controls).
However in the results I have not been able to detect any DNA bands in the gel electrophoresis with one exception.
I had 2 amplification mixes - one for the fax1 gene and one for the tfax1 mutation (insertion of tDNA).
I used 1.5% agarose gel in 1*TAE buffer with 2ul GelRed per 100ml gel.
and inserted 20ul sample in each of the gel pockets.
Where could the problem be?
(i apologies for any unclarities and mistakes in my question)
Thank you in advance!
I am using BIO0-RAD Tubes and Caps for my PCR Reactions, so when PCR starts the tubes are opened (95Celsius). What i have to do?
Question
7 answers
- Kiriakos Athanasiadis
I am using PCR Instrument called SLAN from HONGSHI. Any clue?
Related Publications
Cryptosporidium parvum: Culture in MDCK Cells
Article
- María José Rosales-Lombardo
- J Cifuentes
- Carmen Mascaró
Differences in Cytopathology Between Canine Adenovirus Serotypes
Article
- B.M. Adair
The development of inclusions produced by canine adenovirus (CAV) types 1 and 2 was studied in MDCK cells. Differences were noted between the two viruses in the types of inclusion produced, particularly in the early stages of infection. CAV-1 gave rise initially to multiple refractile eosinophilic inclusions similar to human adenovirus types 2, 5 a...
Association of a P2RX7 gene missense variant with brachycephalic dog breeds
Article
Full-text available
- Reece Andrew Sophocleous
- V. Sluyter
- B. L. Curtis
- [...]
- Ronald Sluyter
Missense variants are associated with various phenotypic traits and disorders in dogs. The canine P2RX7 gene, coding the ATP‐gated P2X7 receptor ion channel, contains four known missense variants. The current study aimed to examine the presence of these variants in a random sample of pedigree and mixed‐pedigree dogs. Exons 3, 8, 11 and 13 of the P2...
Got a technical question?
Get high-quality answers from experts.
Top contributors to discussions in this field
Go J Yoshida
Salameh Barhoom
Paul Digard
Ilya Korotetskiy
Nurshariza Abdullah
Join ResearchGate to find the people and research you need to help your work
- 25+ million members
- 160+ million publication pages
- 2.3+ billion citations
or
- Join for free
- LoginEmail Tip: Most researchers use their institutional email address as their ResearchGate login
PasswordForgot password?
Keep me logged inor
Continue with Google
Welcome back! Please log in.
Email · HintTip: Most researchers use their institutional email address as their ResearchGate login
PasswordForgot password?
Keep me logged in
or
Continue with Google
No account? Sign up
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Cell Biology
- Culture Cells
- Cell Line