I am doing PCR with 16s RNA primer for Ecoli. Tested different thermal protocols (55, 58, 52°C annealing temp) from previous literature but no result.

I got some of my samples showing desired band without any non-specific band at 59° C annealing and reducing the extension time to 45 sec from 1 min. (My master mix produce 1kb/min). My desired band is 585.

But, most of the samples still showing too many non-specific bands.

At last, today I performed a gradient PCR (annealing temp ranging 52°C to 61°C) with one of the samples that gives non-specific band.

But still there is no result.

What can I do?

I am using primer-

F- GACCTCGGTTTAGTTCACAGA

R- CACACGCTGACGCTGACCA

Master mix- EmraldAmp Max 2x

Desired band- 585 bp

DNA ladder use- 100 bp

I have attached my gradient pcr picture.

And another picture of the samples that didn’t show any non-specific band.

All sample DNA were extracted using boiling method from single colony of Ecoli.

How to solve this problem?

More Tonmoy Chowdhury's questions See All
Similar questions and discussions