How to diagnose a bilateral Inferior oblique palsy on the basis of Parkes three step test?

Sana Nadeem @Sana-Nadeem

31 August 2018 0 6K Report

What if there is no hypertropia in bilateral inferior oblique palsy?

Can there be equal hypertropia on head tilt to the right and the left?

Badges
Science topic

More Sana Nadeem's questions See All

How can I find the cracked version of ENVI-met software?

Envi-met software

07 August 2024 8,188 1 View

Entropy measure and QSPR modeling in Graph Theor. How to construct the table for lengthy equation?

The entropy measured of molecular graphs plays a crucial rule. The network structures in some cases are very lengthy calculations to handle. Some author avoid to construct table where as most...

30 July 2024 3,126 0 View

Critique Calculaltion in Topological Indices and QSPR Modeling?

The first step is to analyze a 2D molecular graph and implement partitioning techniques to calculate the topological indices. Secondly impose statically tools to generate QSPR model, may or may...

24 July 2024 9,644 1 View

What strategy should be adopted to calculate topological indices efficiently?

Most of the time it is observed that in many manuscripts there are several typo error of topological calculation errors of calculation and partition of edges what ever the type of partitioning it...

22 July 2024 811 0 View

Regarding solubility of Dorsomorphin in DMSO ?

I'm using Dorsomorphin (C24H25N5O) as one component in dual SMAD inhibition of pluripotent stem cells to differentiate into neurons alongwith SB431542. Now as to solubilizing 10mg SB in DMSO for...

11 July 2024 4,832 0 View

To prepare polymethyl methacrylate polymer for the study of acoustic properties without of bubbles during this process, what measures should be taken?

To prepare polymethyl methacrylate polymer for the study of acoustic properties, a mixture of methyl methacrylate monomer and benzoyl peroxide is used. This mixture is then heated and placed on a...

27 June 2024 2,087 1 View

Nicotiana benthamiana seeds sterilization methods for tissue culturing?

I have been trying to grow Nicotiana benthamiana via tissue culture. I used ethanol and sodium hypochlorite with different concentrations and time duration for seeds sterilization and lastly...

18 June 2024 1,756 3 View

As a university teacher, devise effective teaching methods to enhance students' presentation skills?

ABSTRACT The study explored the relationship between mindfulness levels and academic performance among prospective teachers in the subject of Technical Writing and Presentation Skills at the...

14 June 2024 2,867 2 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,777 1 View

How to add viscosity into a hyperelastic material such as Mooney-Rivlin rubber in LS-DYNA?

Hi, I am working on a head FE model and want to try different material types on brain. I read some papers that use Mooney-Rivlin rubber model and wondering if i can add viscosity into it. Is it...

24 July 2024 5,908 0 View

Identity behind this address?

May I request for change of pofile for this email address? It belongs to the ofice of the head of institution but the name attached is different. Kindly also include [email protected] being the...

17 July 2024 1,145 0 View

Smart spectacles for paralysis people using the eye blink sensor it will detect the blink and provide what they need?

a man was facing a paralysis problem.. he wants some drink or else food not even he ask, because he paralyzed .while he put the smart spectacles he blinks the eyes it will count the sensors and...

13 July 2024 8,021 1 View

What is (or are) the aim (or aims) of the creation of Universe?

Mean to say where the human beings with all belongings are heading to? I seek answers to the point.

26 June 2024 5,066 3 View

Litopenaeus vannamei post-larvae for fatty acid and amino acid profile?

For fatty acid and amino acid profile analysis in Litopenaeus vannamei post-larvae (1-1.5 gr), is it necessary to remove the head and peel? or it's possible to use whole body including head, peel...

04 June 2024 4,497 0 View

Cortical Brain-Computer Interfaces: Thought Control, Movement Control, or Both Control?

“Several recent studies have shown the feasibility of decoding or synthesis [of] sentences of non-tonal languages, such as English (2-10) and Japanese (11), using intracranial neural recordings,...

01 June 2024 8,530 0 View

How do I merge both profiles if K. R. Tarantseva and Klara Tarantseva are the same person?

K. R. Tarantseva and Klara Tarantseva are the same person from Penza State Technological University. I am Klara Tarantseva (K.R. Tarantseva). I am a Head of the Department: Biotechnololy and...

29 May 2024 3,647 1 View

What impact will Ebrahim Raisi’s death have on Iran’s domestic and foreign policies? Are there any potential security implications following hs death?

Impact on Iran’s Policies: Domestic: Raisi’s death may lead to shifts in Iran’s political landscape. Foreign Policy: Immediate changes are unlikely, as the supreme leader holds final...

20 May 2024 3,143 3 View

How to extract RNA from honeybee brains by smashing whole heads in Trizol?

Dear all, I would like to kindly ask for any recommendations on how to extract pure RNA from honeybee brains. After snap-freezing whole bees in liquid nitrogen, I have been smashing the whole...

15 May 2024 7,305 4 View

Do the simulated heads show an increasing trend or does the model require spin up?

I ran Modflow using a 2005 engine over my study area and got my first results. The result at one such location is attached herewith. There is a difference between simulated and observed time...

08 May 2024 6,551 0 View