Hello Andrew

A easy way is to copy the sequence into notepad in the format shown below

>any name (no spaces though)

ATGTACTAGTACGTAGCAGGTAGGATA(sequence)

(sequence must be on line below, and arrow must before name)

Then save it as a text file but after the name put .fas as the extension

This will create a fas file you can repeat this to put multiple sequences in the same doc to create a multi fas which can be read by many programs such as BLAST and MEGA.

Matt

Hello Andrew

A easy way is to copy the sequence into notepad in the format shown below

>any name (no spaces though)

ATGTACTAGTACGTAGCAGGTAGGATA(sequence)

(sequence must be on line below, and arrow must before name)

Then save it as a text file but after the name put .fas as the extension

This will create a fas file you can repeat this to put multiple sequences in the same doc to create a multi fas which can be read by many programs such as BLAST and MEGA.

Matt

HI Matt,

Thank you for replying.

My issue is that what I have from Clustal Omega is the alignment where three species are on consecuctive lines, one after the other. So it looks like this (for example):

ferret__ATGCACTAGGAC

dog___ATGCACTCCGAC

panda_ATGTACTAGGAC

______***.**..***

*=homologous .=non-homologous (these actually lign up but I cannot format in this text box.)

Clustal has shown where the sequences matches or not (there are nine pages of this if we go to 8 point type,) but I would not have one single sequence to submit as text unless I went through all 9 pages, perhaps replacing non-homolous nucleotides with N or some other letter. This of course would take an inordinate amount of time and be prone to human error; so I was wondering how to take a multiple sequence alignment and format that for Primer Explorer without the lengthy hand editing.

All the best Andrew.

Dear Andrew,

Are you going to design a primer for amplification the sequence of one of the species specifically or you need a primer with wobbles with ability to amplify all of the species? If you are intended to amplify specifically one of them then you should find sequences which show little conservation among those species and introduce them to the primer design software then you can have a primer with specificity for that species but don't forget to place the 4-6 nucleotides of the 3' end of the primer in the region with no conservation. On the other hand if you need a primer for amplification of all species you should find a region with high conservation then introduce it to the software, conversely the 4-6 nucleotides of the 3' end of the primer should be in a region with complete conservation. Also, use redundant nucleotides (wobbles) for the positions without high conservation.

Dear Sharifi,

Thank you! I am very new to all of this, so let me parse that:

I am actually after the first; a single species. However, it is none of the species for which I have a sequence but it is in fact a closely related species.

From what you say, I should choose a region that is the most differentiated between these closely related species, and use these (from 4 to 6 nucleotides in length) for the start of the 3' end of the primer. Is this correct?

Should I also be looking for a non-conserved sequence to become my 5' end ?

I have not heard the term 'wobbles' - does this mean an area of DNA that does not bind to anything but simply holds the strand together so that conserved areas can loosely fit across it?

Thank you, I very much appreciate your comment.

All the best, Andrew.

Dear Andrew,

Basically, if you are facing with organisms genetically identical and you want to amplify one of them specifically then I suggest you to perform an alignment with MEGA5 for nucleotide sequences of those organisms. You will find conserved (homologous as you mentioned above) nucleotides easily. Just try to find a region with around 30-50 nucleotides which has little conservation. Also, remember this region should contain around 30-60% GC content and has enough complexity (avoid low complexity such as poly A or PolyT). Find one region with these characteristics for forward and also a one for reverse primer. Now i suggest you to use primer-blast software (it is web-based and user friendly). Introduce the sequence of your desired organism to the software and assign the sequence of that 30-50 nucleotides for the forward primer and that 30-50 nucleotides for the reverse one in the software (you can easily define the region you desire to have your primers in by the software). Set all other parameters for your primer and finalize the primer design. The software will offer you different pairs of primer, just try to select a pair which the 3' ends of both forward and reverse primers located on non-conserved positions. Also, consider the specificity of your primer with the software. As a result, the idea you have mentioned above for the 3' end is right. On the other hand, It is not obligatory to put the 5' end in a non-conserved region.

Wobbles are redundant nucleotides in the sequence of the primer such as W, K, R, etc. for example you can design a primer like this: 5'-ACTGTGACCCGWGCTAGYCTG-3' and order it for synthesis.

as you see there are two wobbles; one W and one Y in the sequence of primer. Exactly it mean you will have the mix of 4 different primers in the tube you will receive, including:

5'-ACTGTGACCCGAGCTAGCCTG-3'

5'-ACTGTGACCCGAGCTAGTCTG-3'

5'-ACTGTGACCCGTGCTAGCCTG-3'

5'-ACTGTGACCCGTGCTAGTCTG-3'

Please let me know if i can help you more.

Yours,

Heidar