Ask for help about wannier90, hopping matrix elements are not complex conjugate?

Dear All, I calculate band structure and hopping matrix of monolayer Graphene by using wannier90-2.0.1. There are two atoms in one unit cell, the following is input information : INCAR :...

26 February 2020 4,885 1 View

How to calibrate a T/C CO2 sensor in an air-jacketed CO2 incubator without an independent CO2 sensor?

I have an air-jacketed CO2 incubator and I need to calibrate its thermal conductivity CO2 sensor. However, I do not have a CO2 sensor that is independent of the incubator to measure the CO2...

31 January 2020 8,758 1 View

What is a good procedure to identify if the CO2 incubator is the source of contamination in my cell cultures?

I have read some vague descriptions about how to screen the CO2 incubator as the source of contamination. I saw recommendations to leave a plate of cell culture media in the incubator and view it...

12 January 2020 8,639 2 View

Have problems in insert sgRNA into lenticrispr v2 vector?

my oligo forward: 5`->3`:CACCGCTAGACACGGAATCATGCCG reverse 5`->3`:AAACCGGCATGATTCCGTGTCTAGC I done all things stickily followed the zhanglab protocol-Target Guide Sequence Cloning Protocol,...

28 December 2018 4,592 3 View

How to measure the perceived contradiction of "need certain resource yet cannot acquire it"?

How to measure the perceived contradiction of "need certain resource yet cannot acquire it"?

28 March 2018 6,378 2 View

Can I run a multiple regression with 150 cases altogether with hormones as independent variables to predict birth weight?

12 October 2016 6,081 4 View

What is the proper stimulation point (dosage and time) for VSMC proliferation?

20 February 2015 2,729 1 View

Do you starve PBMCs before LPS stimulation?

I'm maintaining mouse PBMCs in 10% FBS for a LPS stimulation experiment. I'm going to plate the cells in 96-well plate and treat them with LPS for ELISA. Just wonder if you guys starve the cells...

07 November 2014 9,702 5 View

Why is there so much discrepancy between the lanes when using the BCA method determine to protein concentration?

23 September 2014 3,838 7 View

Is a high fat diet with induced obesity a good mice model for fetal growth restriction?

I am pretty confused after reading these studies about this topic. http://www.fasebj.org/content/23/1/271. Short mice are treated with a high fat diet for 8 weeks, resulting in fetal...

26 April 2014 502 2 View

Why does blocking with my immunogenic peptide cause nuclear fluorescence in ICC?

Hi all, I am validating a polyclonal antibody raised against human ANT4, through WB and ICC. In most of my controls, the antibody shows very little off-target binding, but when I pre-incubate the...

03 March 2021 5,999 3 View

Have someone successfully used the ER alpha (Santa Cruz sc-8002) antibody in immunostaining ?

Santa Cruz now recommends this new antibody (F-10) but I can't find a publication using this reference. I'm working on human et non human primate hypothalamus and so far, it doesn't work. Is...

02 March 2021 10,003 2 View

No title

02 March 2021 3,060 3 View

Issues with Permeabilization during Flow Cytometry?

Hello Everyone. Currently I am working to characterize macrophages in the myocardium after ischemia-reperfusion injury in rats. Due to the low total cell number isolated from rat hearts I can...

01 March 2021 3,867 3 View

Does anyone know an alternative product for cardiac Troponin T antibody for Immunofluorescence (Thermo # MA512960)?

We have been using Thermo Fisher anti-cardiac Troponin T antibody for immunofluorescence staining in FFPE mouse heart sections but it was recently discontinued. The literature shows it to be the...

01 March 2021 4,937 1 View

Which cell line should we use to perform biological dosimetry experiments?

We are preparing some experiments based on irradiating cells under different conditions in order to evaluate the effects in terms of DNA damage, genetic expression, etc. As our project is...

01 March 2021 3,355 3 View

Is it possible for two human neuronal cell lines to have different gene sequence for the same protein?

I am looking at the ATP1A2 (Sodium/Potassium ATPase alpha subunit 2) in two human neuronal cell lines. Expression levels of this protein seems to be almost equal when detected by one antibody....

01 March 2021 3,607 3 View

Is CD44 degraded in lysosome together with hyaluronan after CD44 mediated endocytosis of hyaluronic acid?

Also when RHAMM binds hyaluronic acid, they get internalized, will RHAMM also be degraded? Or both CD44 and RHAMM will be transferred back to the cell membrane? Asking for breast cancer cell line...

01 March 2021 8,169 2 View

Do you need the CMV enhancer before the CMV promotor for a proper function of CMV on the gene that follows?

I'm a student and I have to produce a cell line with a knockin for the NRF2 gene with GFP. I have to put a promotor in front of the GFP because the gene will be too far away from the promotor of...

28 February 2021 7,127 2 View

How does an antibody have full intact antibody + half antibody?

Hello, I was just wondering how does a antibody have full intact antibody + half antibody? Is it because of the drug conjugation?

28 February 2021 1,577 1 View