Hi Liang,

Can you give some details on what you have done previously that has not worked? Also what plasmids are you using for the red recombinase?

Hi Tom,

I'm working on a MDR Enterobacter cloacae. I modified the pKD46 with kanamycin resistance gene(pKD46-kan), and get the strain of Enterobacter cloacae/pKD46-kan.

I constructed the homologous DNA by using a Zeocin's marker.   However, I failed to detect any recombination.

The target gene is 3.1kb , my homologous DNA is 700bp with 50bp  homologous sequences.

I could detail my questions as:

  a.   The amount of  homologous DNA  is ??

  b.   Should I add L-arabinose to SOC/LB after recover the cells? ( I saw somebody added it)

Or, someone could give any information. 

Thanks.

What Tom was asking is what are your growth conditions, medium, temperature, induction conditions etc. Also are you sure that you have the orientation of both homologous regions correct? I have frequently seen where someone designed one size and it was in reverse.

 Hi Michael,

I briefly describe my strategy as:

• 30C incubation in LB-kanamycin (25ug/ml)
• When OD600 of cells(+pKD46-kan) reaches 0.2 , add  L-arabinose 40mM.
• about 1hour incubation to OD600 = 0.4 
• 1ml cell culture  to make 60ul electroporation competent cells.
• 1ug DNA+50ul  competent cels  for electroporation
• Recover with 1ml LB, incubate it in 37C 1.5 hours
• Spread them in selective plates (125ug/ml Zeocin, I use Zeocin for selection, and this concentration is higher than recommendation).

Primer design:

target gene:

gaaaatgaaaaaggccgctaatgcggcctttttatcatgtgaaaccggtatcagtgaggttctaccgaat…………...gcgatcacccacgcaaatatggggcgatcgataaagaaattaggcatgtcttaacggctcctgtttaagttaagacttggtttgttctgactggccag

the homologous arms are bolded.

My primers:  5->3

gaaaatgaaaaaggccgctaatgcggcctttttatcatgtgaaaccggtaatacaggtggcacttttcgg

ctggccagtcagaacaaaccaagtcttaacttaaacaggagccgttaagacacgttaagggattttggtcatga

the Zeocin  resistant gene's primers are bolded.

Thanks.

Liang

Have you confirmed that you get a good PCR product after amplification? If so then it is likely that either your electroporation is not sufficiently efficient or your zeomycin concentration is too high so that you are losing your recombinants. 

I agree with Michael that its most likely your cells/electroporation are not efficient and/or the zeocin is too high. Is your L-arabinose stock fresh? Have your tried using pSIM6 instead of pKD46? pSIM6 is the red recombinase under a heat inducible promoter (42 degrees C for 15 minutes). I found pSIM6 worked better than pKD46.

What size culture are you starting with to make your cells competent? I always started with 250ml culture which would eventually be spun down and resuspended in ~0.6ml. Are you washing the cells with ice cold water or glycerol? What size cuvette are you using? I used 0.2cm gap cuvette/100ul cells, 100ng PCR product and 1.8kV. What is the time constant reading after you electroporate? If it is not greater than 5.4 milliseconds then it most likely will not work. The longer the time constant the better the transformation. You may want to recover the cells in SOC media instead of LB since it is very low salt and contains glucose. Have you tried reducing the zeocin concentration to see if anything grows?

      To get the best competent cells, they need to be made on exponentially growing cultures.  At 30C, you got to OD600 = 0.4 very quickly (1 hour?).  If your cultures hit stationary phase, they will not be good competent cells.  Make dilutions of an overnight culture that gets you to OD600 = 0.4 in about 4 hours at 30C and then induce.  also, I would make sure that the cells are firmly in the exponential growth phase before induction, OD600 = 0.2 is right at the start in E. coli that I work with. Also, the OD is a function of cell density, so a higher OD will give you more cells/mL.  It is also possible the parameters you use for electroporation are incorrect for Enterobacter cloacae.  The manual provided with your electroporation setup may have suggestions for the settings for your particular species.

   Lastly, if you do mock electroporations with water instead of DNA and plate these on ZeoR plates with varying conc. of Zeo you can determine  the MIC.  When I make my own competent cells, I always do a "mock" control in electroporation experiments to make sure my competent cells are truly sensitive to the antibiotic and that the antibiotic concentration is sufficient.  When you are moving markers into the chromosome the copy number is effectively equal to one; much lower concentration of antibiotic should be required for selection.

     I spin the cells down (4,000 g, 10 minutes) and wash 3-4 times with Ice-cold dH2O followed by a final wash with ice-cold 10% glycerol/dH2O.  I work with E. coli, but hopefully these tips will help.

Thanks Terry, Tom,Michael.

I'm adjusting the parameters of this experiment under the your helpful information. 

Does the target gene's size affects the efficiency?

My target gene is 3.1kb and much bigger than the replacement ( 1.4kb )?

Liang

Tom Masi , I want to ask a question here. As you have mentioned earlier that pSIM6 works better than pKD46. Can we use pSIM6 for using recombineering system in Pasteurella multocida. Because I am facing a problem in my experiment where I am trying to transform Pasteurella multocida with recombineering plasmid.

Best regards