How can we induce iron deficiency in normal mice??

More Khawar Saeed's questions See All

What is the method of measuring the amount of anthocyanin in plant tissues using spectrophotometer and extinction coefficient?

How to enter the extinction coefficient in the calculation of the amount of anthocyanin?

15 June 2024 1,181 1 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,777 1 View

Interested in joining us as an editor?

Call for Editors: TESOL Today TESOL Today, a distinguished scholarly journal at the forefront of Teaching English to Speakers of Other Languages (TESOL) and Applied Linguistics, is seeking...

08 May 2024 1,070 3 View

Interested in joining us as a reviewer?

Dear TESOL and Applied Linguistics researchers, Greetings, TESOL Today invites educators, researchers, and practitioners in the field of Teaching English to Speakers of Other Languages (TESOL)...

02 May 2024 244 3 View

How to prepare chitosan solution 8% in TFA:DCM??

Practically it forms gel

10 March 2024 3,127 1 View

Can some please explain how can i apply element birth and death technique for the multipass welding simulation? and what logic should i Used?

As i am doing multipass simulation with APDL Subroutines and at that time i had no idea how can i apply Element birth and death technique for simulation. And what logic should i used for the...

23 February 2024 3,833 0 View

evolution of skull of viperidae ?

study about evolution of skull of viperidae. some body help me about this.What studies have been done in this regard so far?

20 February 2024 4,804 0 View

Where are the qualified researchers in management and HR?

We are looking for a research group that contains a research group in the field of management and human resources?

16 February 2024 9,102 6 View

Which formula can convert odds ratio (OR) to relative risk (RR) for continuous variables in adjusted models?

I am working on a meta-analysis that examine the dose-response association of fasting plasma glucose (a continuous variable) on incident cardiovascular diseases. Although in most of the original...

06 February 2024 9,277 1 View

How to select target material for X-Ray generation?

Generally, the target material is Mo, Co, Cu, Fe, Cr, etc, so on what basis should we choose this material?

31 July 2024 5,824 0 View

What is the solubility of Iron (+3) in Bismuth Oxide?

Dear all: I am modifying Bismuth Tungstate with Hematite (Fe2O3), so I would like to know about how much Iron(+3) can form a solid solution in a Bismuth Oxide matrix. Best wishes Marco

29 July 2024 2,163 1 View

Is it true that there is a physico-statistical meaning to the constant π other than circular geometry but the iron guardians of the SE deny it?

We assume that there is a physico-statistical meaning to the constant π other than circular geometry, but the iron guardians of the Schrödinger equation deny this. The iron guardians of the...

22 July 2024 4,285 9 View

Surface adsorption with the help of iron and UV/H2O2 is innovative?

1.The topic I am going to research is "Advanced Gray Wastewater Treatment Output from the Biological Process by Iron-assisted surface adsorption and UV/H2O2". I think this method has been used a...

08 July 2024 9,464 1 View

What can be done when electronic minimization does not converge during geometry optimization in CASTEP?

Hello All, I've been facing difficulty in executing geometry optimization of a sodium polyanionic phosphate (Na4Fe3P4O15) crystal in CASTEP (please find the input and output files attached). When...

07 July 2024 8,626 2 View

Pressure in Iron Iron Carbide?

What will be the pressure in Iron Iron-Carbide diagram? It is at atmospheric pressure?

05 July 2024 1,891 0 View

In scf input file if celldm(1) is used in bohrs unit,inorder to consistency of units is atomic position needs to be in crystal?

here is scf file &CONTROL title = 'cal' calculation = 'scf' etot_conv_thr = 4e-6 forc_conv_thr = 1e-6 pseudo_dir='./' !tprnfor = .true. !tstress =...

29 June 2024 10,082 0 View

Which size of undersized iron pellet is suitable for sponge iron tunnel kiln production?

Someone advise me to use 1 to 2mm undersized pellet but it is not available. Do anyone have any experience in the field of tunnel kiln ?

28 June 2024 6,355 0 View

Can anyopne help me with Ac magnetic propoerty measurement (Fe Core Loss) using BH analyser ?

I am working on magnetic materials. I need to measure the iron core losss for my samples. can anyone help me with Ac magnetic propoerty measurement (Fe Core Loss) using BH analyser if possible? i...

26 June 2024 7,176 0 View

What is the JCPDS number of Graphite, copper, lithium, and Iron?

We are willing to make notice of Miller indices present in XRD powder and managed as their JCPDS files. We need them for various substances, e.g. Graphite, copper, lithium, and Iron. Kindly share...

23 June 2024 864 2 View