I am working on an EST data assembly and annotation project. After screening with VecScreen no significant matches were detected. As a cautious step, we plan to trim the terminal 25-30 nt length from both ends of each EST sequences before subjecting it to further assembly steps. Is it right option? If yes can you suggest tools and ways to do this trimming for the large datasets?
The best way is to use usegalaxy.org EST Trim option subset to 'n' number of bases to trim. Else you may use the IPK gatersleben, German based free Perl script:
http://pgrc.ipk-gatersleben.de/misa/download/est_trimmer.pl
Please crosscheck twice whether or not it is Open Source.
One of the many ways would be to use bash "sed" with a small script. If you had two files myseq and myseq2 with sequence:
acctgactgcgcgatgcgcgatggacgtgcgcatttgggctggcgcgcgcgaaaaaaa
and
GATTCATCGATCTGCTAGTCGTGACATCGTACTGTGCATGTGTGCATGCTAGCTGTCAGTGCATGCTAGCTGATC
respectively, for example, the command:
sed 's/^.....//; s/.....$//' myseq*
will trim the first and last 5 characters from each file:
actgcgcgatgcgcgatggacgtgcgcatttgggctggcgcgcgcgaa
ATCGATCTGCTAGTCGTGACATCGTACTGTGCATGTGTGCATGCTAGCTGTCAGTGCATGCTAGC
- Badges
- Science topic
- Similar topics
- Computer Science and Engineering
- Bioinformatics