How can I get good PCR protocol for the exon4 of LDLR gene?
This link maybe useful
Single step PCR for the identification of Low Density Lipopr...
You can find suitable PCR protocols here:
http://www.jlr.org/content/44/10/1850.full.pdf
https://edoc.hu-berlin.de/bitstream/handle/18452/12424/asami.pdf?sequence=1
Exon 4 primers:
Forward Primer: TGGTCTCGGCCATCCATCCCTGCAG
Reverse Primer: ACGCCCCGCCCCCACCCTGCCCCGC
Thank you for this information on this topic
Thank you very much
Why does my PCR, that i optimized, now give weak bands or smears?
31 December 2017 4,411 9 View
What is the best way to transfer cultured cells Between cities?
31 December 2017 1,176 4 View
i gain these information from some article
01 January 1970 5,226 2 View
I'm cloning a fragment of 3200 nts into plasmid. The cloning was successful, however, 02 amino acids were mutated. Now I want to fix these 02 aa by site-directed mutagenesis technique using...
08 August 2024 4,645 2 View
After performing symmetric PCR, PCR purification was performed. Afterwards, asymmetric PCR was performed using the PCR purification product as a template, but no ssDNA band was confirmed in the...
08 August 2024 1,668 3 View
i have sorted anti-NP specific plasma cells from bone marrow of C57BL/6 mice at certain times after immunization with variable counts and isolated total RNA using TRIZOL method for RT-PCR using...
05 August 2024 8,835 1 View
A Markov-like Model for Patient Progression" Markov Chain Monte Carlo (MCMC) Markov Chain Monte Carlo (MCMC) is a powerful computational technique used to draw samples from a probability...
05 August 2024 10,079 0 View
I want to introduce a point mutation (change in one nucleotide) into my gene of interest (DNA binding domain) I have designed primers as recommended on the Data sheet of the kit : -Both primers...
05 August 2024 9,059 3 View
I am performing ligation of the plasmid and a target gene. The steps I have taken are: 1. Double digestion of the plasmid and target gene 2. Ligation of the plasmid with the target gene 3....
05 August 2024 2,570 3 View
I am having an issue with my gel image where my PCR product is not appearing very bright on the gel. When I perform gel extraction, the A260/280 purity value is very low. I used the Qiagen gel...
05 August 2024 9,798 3 View
Read the journal article by Douglas M. Lambert, “The Eight Essential Supply Chain Management Processes,” Supply Chain Management Review, Vol. 8, No. 6 (2004), pp. 18-26
04 August 2024 9,919 4 View
How does the atmosphere affect the flow of matter and energy on Earth and flow of energy in the biosphere related to the flow of food through a food chain?
02 August 2024 9,644 0 View
I have been attempting to extract DNA from Bacterial, Fungal and Yeast banked samples (>1e7 cells) using Prepman Ultra reagent and I seem to be struggling to obtain a sequence. Although the...
01 August 2024 2,079 0 View