How can I get good PCR protocol for the exon4 of LDLR gene?
This link maybe useful
Single step PCR for the identification of Low Density Lipopr...
You can find suitable PCR protocols here:
http://www.jlr.org/content/44/10/1850.full.pdf
https://edoc.hu-berlin.de/bitstream/handle/18452/12424/asami.pdf?sequence=1
Exon 4 primers:
Forward Primer: TGGTCTCGGCCATCCATCCCTGCAG
Reverse Primer: ACGCCCCGCCCCCACCCTGCCCCGC
Thank you for this information on this topic
Thank you very much
Why does my PCR, that i optimized, now give weak bands or smears?
31 December 2017 4,340 9 View
What is the best way to transfer cultured cells Between cities?
31 December 2017 1,087 4 View
i gain these information from some article
01 January 1970 5,166 2 View
Hello, We would like to increase the yield of our PCR product. We are running a series of PCR reactions that is targeting ~1.1kb sequence. We begin each reaction with ~400pg of template DNA...
02 March 2021 4,029 3 View
Hi, I am planning to apply for the PhD degree in the Supply Chain Mgt. with specific area of "Cold Storage warehouses" during Pandemics and wars. Where lock downs and shut downs are frequent....
02 March 2021 285 2 View
So, I have been trying to run a pACYC PCR which will be used later on for a Gibson Assembly. However the PCR is not working. I have already tried gradient PCR and changing extension time; however...
02 March 2021 1,146 2 View
I am going to have 3 different probes in my qPCR work that I am going to do. But I realized that the machine we have in the lab is a Rotor-Gene Q 2plex HRM Platform, saying it has green, yellow,...
01 March 2021 8,544 1 View
To dear Researchers, I was analyzing a series of concentration for estimation of Real-Time PCR efficiency. The concentration was 1:10. I used MS-excel to evaluate Slope. The result of slope was -8...
01 March 2021 8,683 4 View
Does anyone have the experience of using Taq Man probes in the QIAGEN Rotar- Gene qPCR machine?
01 March 2021 5,311 1 View
Dear All, mirna primer showing some problem in the melting curve? any idea why? As attached is the melting curve. The forward sequence is obtained from miRBase and reverse primer is universal.
28 February 2021 5,008 4 View
I performed site directed mutagenesis, transformation, and then I sent out plasmids for Sanger sequencing and found out that there is extension of DNA just before the stop codon. I am not sure...
27 February 2021 547 3 View
Hi, my question is about the heating of thermal cycler machines and I hope some of you had experienced a similar thing previously. There are two thermal cycler machines in the lab(BioRad) and for...
26 February 2021 4,777 4 View
Hi I am a bit confused. They are asking me to find out the volume of DNA required in ul (a total of 30-100 ng for genomic DNA) from the DNA concentration in the nanodrop reading which was 404.8...
26 February 2021 5,029 2 View