5' GGGGACGAAATTGGTTTCGACTGTTGTTGCCAGGGGTTATGTGGCGTGTAGAGGTTGTAGGCTCCTCTAAAAACCTTCAAACAATAACCGCTAATAACGAATTAGCTTTAGCAGCTTAATCTCTGCTACGGAACTTTAGTTTTTTCTCTCGAATTCTAAATGTTCTGACAATGATCGGGAGGCGATTCTTTTGGTTTTTGGTTCCTAAAAGAGTTTGTATTTGAGCCGAATAGGAAAGAGAGTCCTGTCTGAGGGTGAACCTCTTTCCGAAATTTTATACACAGACTACACACGTAGAGGCTGATCTGGGGCGCAATAGGACGCGGGTTCGAACCCCGCCGTCTCCAA 3' - I have this gene cloned in pTZ57R/T plasmid between the sites HindIII (forward) and KpnI (reverse). But I am unable to figure out how do I design a primer that the gene it ends with 3' CCA? Or more specifically if I want to cut and linearize the plasmid I want 3' to end with CCA. So what enzyme shall I use? Because even if I do a mutation and make sure 3' ends with CCA, how will I linearize it then?
You can add a site for a type IIs enzyme downstream of your intended cut sire position at the correct distance to cut right after the CCA sequence.
Just to be sure I understand correctly, you want to add a CCA sequence to the 3' end of your gene, right? In that case, simply include the reverse complement of that sequence at the 5' end of your reverse primer. Keep in mind that if your plasmid has been dephosphorylated, you'll need to phosphorylate your PCR product.
- Badges
- Science topic
- Similar topics
- Engineering
- Electrical Engineering
- Electrodes