Have you ever used one of these primers for Mesocricetus auratus?

Elis Regina Alves Pinto @Elis-Pinto

02 April 2024 0 4K Report

GAPDH 4R- ATTAAGTTGGGGCAGGGACT

GAPDH 4F- AGGCTGAGAACGGGAAACTT

Mesocricetus auratus

ACTIN F- GCGCAAGTACTCTGTGTGGA

ACTIN R- GTCGTACTCCTGCTTGCTGA

Mesocricetus auratus

I can't find a citation of their use in articles. If anyone knows of an article I would appreciate it. I don't know, but I don't think I know how to look...

Badges
Science topic

Similar topics
Chemistry

More Elis Regina Alves Pinto's questions See All

How can i generate a CRISPR knockin mutation zebrafish model with a reporter?

Hey! I aim to generate a transgenic knockin zebrafish line that mimetizes a genetic condtition that leads to a certain disease on human. To do so, I need to insert a codon for mutagenic aminoacid...

14 July 2024 6,240 0 View

Can you identify what is this in my cell culture?

Hi, I have been cultivating Jurkat cells in RPMI supplemented with 10% FBS, and I have observed some small things in my flask. Although the cell growth appears unaffected, I want to ensure that...

16 April 2024 5,466 3 View

Can i publish articles in reputed journals related to teachers as i am already working as an Assitant Profesor?

I am doing Ph.D studies on Organisational Citizenship Behaviour of University Teachers. I am also working as an Assistant Professor. I want to publish articles on OCB relating to Teachers. Can i...

24 January 2024 4,135 3 View

How to calculate DBH for trees with multiple dead and live stems in the same tree?

I am trying to calculate DBH (diameter at breast height) in order to determine the demography and basal area of trees. However, some of the trees have multiple stems which makes it difficult to...

23 January 2024 845 0 View

Tol2 - Is it normal to lose the transgene expression after a few days?

I'm using a transposon tol2 vector (pT2AL200R150G - 10.1534/genetics.106.060244) to create transgenic zebrafish line. We first inserted our gene of interest (GOI) into the BamHI site of the...

21 November 2023 9,618 1 View

Qual a correlação do clima seco com o aumento de síndromes respiratórias no nordeste brasileiro?

Percebe-se um aumento no número de casos de síndromes respiratórias em crianças nos ambulatórios de um cidade localizada no interior do Ceará. Investiga-se a ocorrência dos casos a nível climático...

10 August 2023 7,967 0 View

What is the correlation between the dry climate and the increase in respiratory syndromes in northeastern Brazil?

There is an increase in the number of cases of respiratory syndromes in children in outpatient clinics in a city located in the interior of Ceará, northeastern Brazil. The occurrence of cases at...

10 August 2023 1,917 2 View

What are the consequences of not using validated descriptors in the paper?

While it is common practice in the health field to use validated descriptors available in thesauri or glossaries, in other fields it is apparent that researchers use the terms they feel are most...

03 August 2023 5,352 1 View

Does Bio-Oss cause auto fluorescence during the live and dead assay?

I'm doing some tests with this biomaterial and I came across this challenge when observing cell viability in the fluorencence microscope.

25 June 2023 8,861 0 View

Has anyone tried Nightsea fluorescence adaptor?

We are exploring possibilities to adapt our stereo microscope due to the high cost of fluorescence stereomicroscopes. I recently came across this product...

16 May 2023 9,575 2 View

Personal recommendations for GAPDH antibody?

Hello! I am planning a western blot experiment, and I am looking for GAPDH antibodies to order. In the past, I have experienced a lot of hit-or-miss when ordering antibodies based on just the...

07 July 2024 1,685 0 View

How can I better show my data?

I am validating the expression of several genes by qPCR to confirm transcriptome analysis. After many inconclusive runs, I realised my housekeeping gene (GAPDH) was downregulated in my...

27 June 2024 7,318 3 View

How to produce homogeneous reference gene bands in Western Blot?

Hello, I have been performing Western Blots to study the protein levels of a rodent skin and muscle sample. However, I have not been able to produce homogenous reference bands. I suspect that...

26 June 2024 5,913 3 View

How can I get RAW264.7 cells to differentiate into osteoclasts?

I can't get RAW264.7 cells to differentiate into osteoclasts. I've tested different densities: 5000 cells/cm2 , 10,000 cells/cm² and 20,000 cells/cm² in 35mm polystyrene. I use DMEM medium, 10%...

12 June 2024 4,604 1 View

Is it advisable to run reference genes separately from target genes in a comparative Ct analysis on ABI StepOnePlus due to logistical constraints?

Hi Everyone, I'm reaching out for some guidance regarding conducting a comparative Ct analysis with the ABI StepOnePlus system, and I hope you can help shed some light on my dilemma. Here's the...

11 June 2024 4,044 3 View

Is there any good protocols for dissect VG nerve?

Hi, I'm a student who studies neuroimmunology. I want to analyze mouse vagus nerve with RT-qPCR like this thesis but I don't know how to dissect the vagus nerve I found some protocol videos for...

10 June 2024 2,123 1 View

How to analyse qPCR data of virus-infected or stimulated cells?

Hello everyone, I am extremely confused about analysis of qPCR data after virus infection or stimulations, and I need help. I hope I can explain properly. Let's say we have two different cell...

29 May 2024 6,358 2 View

How to optimize issues with uneven loading control while doing western blot?

I have quantified the lysate by bradford method and loaded 25ug of lysate for SDS PAGE and proceeded for western blot. However, upon detection I see a variation in loading control i.e., GAPDH. I...

15 May 2024 3,433 6 View

How long do human brain tissue samples last after protein isolation?

Hello! I am currently running a western blot using human AD tissue samples. I prepared these samples over a year and a half ago. I am having trouble standardizing these proteins with Beta Actin. I...

02 May 2024 9,588 3 View

Having issue in gene amplification.How will this work?

The common Tm without Restriction site is 61 degrees and the Tm with Restriction site is 71 degrees. The reaction conditions i followed is 95 degrees 3 mins, 95 degrees 30 secs, Tm (60-68) degrees...

02 May 2024 530 3 View