Did you use the same restriction enzymes pre- and post-transformation? The restriction enzymes used before ligation of desired gene and vector can not work once ligation has been taken place.

You need to check weather your post transformation miniprep contains the restriction sites for your restriction digestion enzymes.

Hi Nkemngo,

If you have insert-specific and pasmid specific primer pairs or you can design these primers, I suggest the colony PCR technique.

Before you do any unnecessary minipreps.

Just pick at least 10-20 colonies (depend on the total colony number per plate) with a sterile toothpick (preferred) or sterile 10 ul pipette tip. 1st) wash into 50 ul nuclease free water (use 8 - or 12-well strips for higher throughput). 2nd) with the same toothpick wash into 100 ul 1×LB + antibotic. Store them at 4°C until useage. Then 3rd) streak onto LB-agar+antibiotic plate (master plate) for further useage (put them into incubator at the desired temp. (37°C) for ON). 4th) Heat the NFW sample up 95 °C for 5 min in a PCR machine. Centrifuge the sample at 1000×g, 1 min. Store at 4° or -20°C (longer storage). 5th)The NFW sample can directly (only NFW) use as tamplate in a normal PCR reaction with 2 primer pairs (insert- and plasmid-specific). 6th) After a gel run, you identify positive clones. 7th) Then you can streak the positive samples into a normal 3-5 ml overnight culture+ antibotic from the earlier saved liquid cultures (step 2nd) or from solid culture (step 3rd)). The start from the liquid culture can begin on the same day after PCR result has been available. The start from the solid culture can begin on the next day, because of the ON incubation of the master plate. 8th) Just do the miniprep as you used to. 9th) Do the restriction analysis.

Have good luck!

If you need any help just feel free to write.

Bests,

Tamas

Hi,

Here you can find the pMAL-c2X plasmid map, full seq., etc.

https://www.addgene.org/browse/sequence/142418/

I have used the SnapGene for plasmid work. It's a very good software. It's freeware for 30 days. http://www.snapgene.com/ You can use it for PCR primer design too.

On the Primers tab you can select the undermentioned primers for insert specific colony PCR:

Primer name Seq (5'-3')

MBP-F GATGAAGCCCTGAAAGACGCGCAG

pBAD Reverse GATTTAATCTGTATCAGG

Just need to order these primers. These can be use for later clone screening tasks.

Empty vectors PCR amplicon size: 346 bp

Vector with LDH gene insert PCR amplicon size: 346 bp + LDH gene size.

Bests,

Tamas

Hi Tamas,

Thanks a lot for the brief outline and response. I would do as said and give you feedback.

Best regards,