Hi everybody!
I'd like to add a tag to my cloned protein...but I've some issue to overcome.
1) I've no useful expression vectors with a suitable tag to use
2) in my plasmid there's not suitable restriction enzymes to extract the protein sequence.
so...I was wondering if this strategy can be successful:
generation of 2 partially complementary primers, for example:
BstEII
5'- gtaac CGATTACAAGGATGACGACGATAAG t...... -3' Fw
3'- ......g GCTAATGTTCCTACTGCTGCTATTC agatc -5' Rv
...............................................................XbaI
what if I take an equal quantity and use them to create a synthetic DNA duplex with sticky ends, double digest my plasmid with BstEII and XbaI and ligate it with my synthetic duplex...
what do you think about it?
mmm...yes that could be an option, but...
In both cases I've to generate primers:
for PCR amplification I need a Fw primer with restriction enzyme site (~30nt), for Rv primer I need a restriction site, the tag and my priming sequence (40-50 nt); then set up a new PCR program, make a double digestion, gel purify an then ligate again in the expression vector...
For "duplex" generation...It would be easier (I think, but may be I'm wrong)...
My idea was: my cDNA is already in an expression vector, I've 2 restriction enzymes at the end of it, just put a duplex in a ligation reaction ...and that's it...no?
Did I get it right? You want to oligo clone a tag in an expression vector? In principle it should work. The thing to do is to anneale the oligos, then phosphorylate them with PNK, and properly dephosphorylate the double digested vector. Don't be surprise if you end up with concatemers though. One more point, but from what you said did I get it right that you want to put your tag at the 3' end of your cDNA? Then it won't work with oligo cloning, because you'll still have the stop codon of your cDNA!
Yes...this is exactly what I want to do...
and...no...there's no problem with stop codon in my cDNA because it's cut off to insert the duplex...the concatenamers are not a problem, 'coz the first duplex adds the stop codon...
and all this "Sturm und Drang" of primer and cloning because my PI decided that my engineered protein cannot contain a GFP tag!
so...thanks for all Doctors...hope it works...
is the same...
my original construct has a C-term eGFP...but my lab head told me it cannot be accepted in a paper 'coz it might change the protein folding...
I don't agree...probably she's right...and for this reason she forced me to change the tag
- Badges
- Science topic
- Similar topics
- Cell Biology
- Methods