Hey,
I've a designed a series of primers against ref seq. sequences using Primer-Blast (which uses Primer 3 software) for qPCR. Once I'm happy with the primers, I get an output for the forward and reverse primer in the format of 5'-3'.
eg. Forward: AGGTCCTCAGCTACAAGGAAG
Reverse: CTTCACCAGCCCGTCCTTC
My question is; when I'm ordering my primers from IDT do I need to reverse complement the reverse primer?
No. Your primers are "ready to use", that means: ready for ordering. If you are not sure you can blast your primers in the NCBI Data base and control it. They should find your sequence (if the sequence is in the data base) and show the right direction.
No, the reverse primers you have in that direction takes care of the reverse complement.
Hope it helps..
- Badges
- Science topic