Hi researchers,
I try to find a pair of primers for CXCL12 from publications. One strange thing I found was that, we I use the primers from publication to do blast in NCBI primer tool, they cannot 100% match to CXCL12 gene or even completely match to other sites. Since it's not only one case, what happens behind this? I attach one of the examples here.
Title: "SDF-1/CXCL12 Production by Mature Dendritic Cells Inhibits the Propagation of X4-Tropic HIV-1 Isolates at the Dendritic Cell-T-Cell Infectious Synapse"
Link: http://jvi.asm.org/content/84/9/4341.full
The primers sequence for CXCL12 are:
forward, 5′-TCTGAGAGCTCGCTTGAGTG-3′
reverse, 5′-GTGGATCGCATCTATGCATG-3′
The NCBI primer blast tool link: http://www.ncbi.nlm.nih.gov/tools/primer-blast/
As shown in Fig1, I just past the forward and reverse sequence into the related boxes and don't change anything else in this page. Then I click "Get primers" button at the bottom of the page.(This is how I check primer specificity, hope it's not wrong.)
The result is shown in Fig2. As you can see, it will not bind to CXCL12 at all! Similar situation also happens in other publications I checked. So did I do anything wrong in this procedure?
Thanks for your help!
Hi Shuaichen, To see whether the sequences match the reference genome (independent of primer features such as product length, Tm, or specificity parameters), you can use the traditional NCBI BLAST rather than Primer Blast. You may be setting the primer characteristic filter such that possible primer sets with sequence matches are excluded. Running a quick BLAST on this sequence (GTGGATCGCATCTATGCATG) yields a perfect match to human CXCL12. My guess is that if you change the filtering parameters around in Primer Blast, it will come up there as well.
Many primers in the published literature are not perfect based on optimal Tm and possible non-specific binding. You may need to try these and/or other primer sets in your assay of interest to find those that will work robustly in your hands.
Hope this helps.
-Benjamin
Hi Benjamin,
Thanks for your reply! I tried your method to blast but didn't get exactly the same result as you. As shown in Fig3(I select the results and put them together), for CXCL12, variant 1 and 4 are 95% covered. For SDF-1a, the coverage is 100%.
I know only a few about this gene now but based on what I know, CXCL12 is also called SDF-1 and CXCL12 has 5 isoforms, namely alpha, beta, gamma, delta, 5. I assume in the blast result, SDF-1a equals to CXCL12 alpha (also named variant 1). But the full name for SDF-1 should be Stromal cell-Derived Factor 1, not pre-B cell stimulating factor homologue (SDF1a). Also, in the last column, if not wrong, NM_****** means human sequence. I don't know what does L***** mean.
I also did blast for this SDF-1a and CXCL12 variant 1 (mRNA), the identity is 1838/1852(99%). I don't know if this SDF-1a is really human sequence. If it is, then why the identity is not 100%? Since they should be the same sequence.
Can you give me some idea about this? Thank you so much!
An updated, I found in one review, CXCL12 is also known as pre-B cell gowth stimulating factor (PBSF).
- Badges
- Science topic
- Similar topics
- Bioinformatics
- Bioinformatics and Computational Biology