GRANT PROPOSAL

MOLECULAR BIOLOGY

HOW CAN THE COMMERCIALLY AVAILABLE TELOMERASE ACTIVATOR TA 65 ENHANCE TELOMERASE EXPRESSION?

THOMAS F. HAHN, M.S.

INTEGRATED M.S.-Ph.D. STUDENT IN BIOINFORMATICS

DONAGHEY COLLEGE OF ENGINEERING AND INFORMATION TECHNOLOGY (EIT)

UNIVERSITY OF ARKANSAS AT LITTLE ROCK

UNIVERSITY OF ARKANSAS FOR MEDICAL SCIENCES

The 2 main papers on which this proposal is based are:

Harley, C. B., Liu, W., Blasco, M., Vera, E., Andrews, W., H., Briggs, L., A., and Raffaele, J., M., 2010. A Natural Product Telomerase Activator As Part of a Health Maintenance Program. Rejuvenation Research 14(1):45-56. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/20822369

de Jesus B.B, Schneeberger K, Vera E, Tejera A, Harley C.B, Blasco M.A. (2011).The telomerase activator TA-65 elongates short telomeres and increases health span of adult/old mice without increasing cancer incidence. Aging cell. Aug;10(4):604-21. (Retrieved from http://onlinelibrary.wiley.com/doi/10.1111/j.1474-9726.2011.00700.x/pdf)

ABSTRACT:

Only by stopping and preferably reversing the aging process, immortality is possible. Aging is the gradually progressing - and so far inevitable - decline of physiological functions eventually leading to death. Age-related diseases are caused by impairments of essential metabolic pathways to such an extent that they are significantly impairing the vitality of the organism as a whole. Many age-related diseases are adversely affecting the nervous system and/or cardiovascular system and are often the final causes of death. Telomerase overexpression has been shown in mouse studies to lead to extended lifespan [Bernades et al]. It has also been shown by Harley et al, that a natural compound TA-65, when taken as a dietary supplement drastically reduced the percentage of senescent cells in individuals. These results come only as recent characterizations of the contents of dried roots of Astralagus used in traditional Chinese medicine. De Jesus et al further showed that the effect of TA-65 is telomerase dependent; in this proposal I am outlining experiments to further characterize the molecular mechanism of TA-65 and determine its ability to help slow down the aging process by enhancing telomerase activity.

MOTIVATION FOR THIS PROPOSAL AND LITERATURE REVIEW

The most important thing one possesses is life. Given that we are - who we are - exclusively due to our experiences, their subjective interpretations and our conclusions drawn from them, the sense of life is vanishing as soon as we can no longer retrieve our experiences, add new experiences (memory loss) or learn from them (insanity). Death is ending these functions permanently. Not worrying about the end of life - which so far still seems inevitable - is like not worrying about backing up one's data from a hard drive because it will eventually inevitably fail permanently. Lacking a backup would then render all efforts devoted to create the then no longer accessible files meaningless.. And then - from the perspective of any time point after such a permanent hard drive crash - it is completely irrelevant whether the broken hard drive has worked well for 10 years or for only 3 days. Everything on it is permanently deleted. The same happens to our memory (which can be compared to the limited lifespan of a hard drive) at the end of our lives, unless we'll make sure that our lives will no longer end while we are still capable of doing so because this is the only way to give any permanent meaning to our lives, our efforts, our experiences and our conclusions. If we cannot preserve our memories in any way, then they are worthless because even those who outlive us and may remember us long after we passed away will eventually die too. Maybe everyone is having a small impact on humanity as a whole, but from the perspective of a deceased individual, his/her death has rendered his/her past life meaningless because the capabilities to retrieve past experiences and to make new ones are irreversibly gone. Therefore, while we still can, we should devote as much efforts as possible towards preventing such meaninglessness. Ignoring the problem of death is not making it any less urgent - but on the contrary - is shortening the remaining time span to do something about it before it is too late.

The final causes of death have changed significantly in the past, partially due to improved and much more differentiated diagnostics, e.g. around 1900 many deaths were attributed to old age and hence categorized as such although they would have been attributed to cancer today.

Also, in the past many people died of bacterial and viral infections: TB, pneumonia, flu epidemics. Antibiotics, for a while, have significantly reduced death from bacterial infections; however, antibiotic resistance could change this in the near future.

Another reason for the shift in the proportions of causes of death is the significantly increased life expectancy in the developed world. When life expectancy was shorter there simply wasn't enough time for developing age related degenerative diseases such as Alzheimer and Osteoporosis because other limiting factors, such as infectious diseases, caused death much sooner.

The figure below is comparing the final causes of death in 1900 and 2010.

📷

(Fontana et al., 2010)

Caloric restriction can also extend lifespan but in isolation it can never lead to immortality as the graph below is showing.

📷

(Fontana et al., 2010)

The beneficial effects of Dietary Restriction (DR) were discovered through loss of function mutations in the TOR (Target of Rapamycin) food sensing pathway. However, loss of function mutations cannot extend our lifespan indefinitely since they are only limiting harmful effects but don't address all components, which are contributing to the aging process. We also need new gain-of-function mutations resulting gene expression that are causing life extension.

Model organisms have been used to elucidate the underlying causes of aging.

Below is an overview about how the inhibition of certain pathways is contributing to longevity in selected model organisms.

📷

(Fontana et al., 2010)

Cancer is another age-related diseased characterized by mutations that are eventually interfering with the cell cycle control mechanism to such an extent that it is no longer properly regulated. If the progression of a particular age-related disease can be postponed and thus temporarily rescuing a particular physiological function, age-related declines of other organ systems are soon causing the onset of another age-related disease until our medical intervention capabilities are eventually becoming insufficient for sustaining even simple survival. However, all age-related diseases can be viewed as different symptoms of an ugly underlying master disease called AGING.

Therefore, the most logical and efficient approach to combat age-related degenerative diseases is to take any measures imaginable that could potentially slow down, stop and eventually reverse the adverse effects of aging rather than only trying to find a cure for every age-related disease individually since such cures are only of temporary nature, i.e. they are only good until the next aging-induced degenerative disease is striking. If the resilience of our body could be maintained at the level of a teenager, most age-related degenerative diseases would not even develop although not all age-related degenerative diseases, such as Parkinson and heart diseases, can be ascribed to problems induced to too short telomeres.

The schema below is showing the antagonistic nature between activated telomerase contributing to the development of cancer on the one hand but lack of telomerase expression is causing accelerated aging.

📷

A possible solution is to maintain the potential for indefinite cell division, which is an essential but not sufficient property of cancer, while simultaneously ensuring that the cell cycle is properly regulated at all times. The benefits of this approach are schematically conceptualized in the following coordinate system.

📷

The X-axis is depicting the level of cell cycle control. Increasing X values imply improvement of cell cycle control declining X values imply an increased failure of the cell cycle control mechanisms. Thus, this diagram is taking into account that the control over the cell cycle is lost gradually rather than all at once since it takes several simultaneous carcinogenic mutations (multi-hit hypotheses) until the failure of the partially redundant and overlapping cell cycle control mechanism are reaching pathological and life threatening levels. Negative X values imply loss of cell cycle control, which is ranging from mild (relatively high negative X values approaching 0, i.e. close to the origin) to severe (much smaller X values that are far more distant from the origin. Analogously the higher the positive X value, the more of the redundant cell cycle control mechanisms are functioning properly. Low positive X value indicate the loss of some redundant cell cycle control mechanisms that are contributing but are still insufficient for developing full blown cancer. An X value of zero implies that this cell is on the verge of turning mildly carcinogenic due to mutations preventing cell cycle control to such an extent that cell proliferation is reaching pathological levels.

The Y axis is indicating the level of telomerase expression, i.e. increasing Y values imply an increase in telomerase expression. Thus the coordinate system above is also accounting for the fact that telomerase expression levels are changing gradually. This assumption is supported by the fact that telomerase expression levels are varying between cell types, i.e. it is high in sperm and egg cells, moderate in stem cells and negligible (but not completely zero) in fully differentiated somatic cells. Positive Y values imply sufficiently high telomerase expression to maintain telomere lengths whereas negative Y values indicate telomere shortening. Thus it is taken into account that the rate of telomere shortening is taking pace at varying rates where decreasing negative Y values that are more distant from the origin indicate a faster rate of telomere shortening. Analogously, increasing positive Y values imply an increased rate of telomere length extension. A Y value of zero implies that just enough telomerase is expressed to keep the telomere length constant.

If we could make our body to consist of cells referred to by the light blue oval in the upper left quadrant, we'd be composed of immortal healthy cells as long as their division is remaining properly regulated. All the cells in the green circle would become cancerous if telomerase were switched on. If however, we could ensure that the cell cycle is always properly regulated, then we could turn on telomerase safely. But as long as this is not possible, we could - as soon as we can - turn on telomerase by default and simply switching it off again as soon as cancer is diagnosed. This however, is requiring improved and much more sensitive diagnostic methods for cancer. A potential pitfall of this approach is that genetically instable precancerous cells are given the opportunity to mutate even more and eventually expressing enough telomerase to divide indefinitely as soon as all necessary and sufficient mutations for carcinogenesis have occurred..

Hence, there is still a lot to learn from cancer because it contains the key to immortality at least on a single-cell level. If we knew more details about how exactly cancer cells are becoming immortal, we'd also be much better in preventing their proliferation at will. Therefore, the expression of telomerase can be compared with a two-edged sword because on the one hand it would allow somatic cells to proliferate indefinitely but on the other hand, it is bringing us one mutation closer to developing cancer (green oval).

But since only about 90% of all cancers are expressing telomerase, there must be another way to maintain the length of the telomeres. In about 10% of all cancers, their immortality is attributed to a process referred to as Alternative Telomere Lengthening (ALT), which is still poorly understood and which probably combines many different alternatives to telomerase-based cellular immortality between which we cannot yet distinguish.

A schematic view of a hypothesis how ALT could extend telomeres is shown below:

📷

Aim 1: Determine the mode of action of TA-65’s increase of telomerase-dependent activity

Administering TA-65 may result in similar beneficial effects as over-expressing telomerase. Both the MAPK pathway and Akt pathway has been shown to increase Telomerase activity. de Jesus at. al. showed that TAT2, a compound structurally similar to TA-65, is activating telomerase through the MAPK pathway and not through the Akt pathway. Therefore, as described by de Jesus at. al. the pathway necessary for TA-65’s effects on telomerase activity can be determined. Each pathway will be inhibited at 2 intermediates as a positive control for efficient pathway inhibition.

Aim 2: Determine whether a prolonged treatment of mice with TA-65 enables lifespan extension with no, minimal, effect on cancer incidence.

TA-65 will be supplemented in the diet of TERT+/- and TERT -/- mice from birth until the development of tumors or their natural death. Telomere lengths will be measured in blood cells every week. Both, the percentage of critically short telomeres and the average telomere length will be compared between TA-65 and placebo supplemented mice divided into a group that is heterozygous for telomerase expression (TERT+/-)).

Background information for accomplishing the first aim:

TA-65 and Cycloastragol (TAT2) are both organic compounds isolated from the same genus of the plant Astragalus (http://en.wikipedia.org/wiki/Astragalus), whose roots are harvested in traditional Chinese medicine for beneficial effects on a person’s immunity. TAT2 is also known for boosting the immune system presumably by increasing the proliferative potential of CD8 and other rapidly dividing immune cells [Fauce et al]. TA-65 is has a similar ring-like structure as TAT2 both of which can be compared in the figure below.

📷

I found this structure in a blog. I was unable to verify the chemical structure of TA-65 from any peer-reviewed journal probably because TA-65 is patented by Geron Inc. and the exclusive rights to commercially marketing TA-65 are granted to TA Science Inc.

Hypothesis:

However, if the structure above is correct (it was posted by a Californian chemistry professor, i.e. Dr. Kayla Kaiser), then TA-65 is a lipid, presumably a steroid similar in structure to estrogen. Therefore, it can be hypothesized that TA-65 might be interacting with PITX1 (telomerase repressor, Qi et. al.) similar to estrogen binding to the estrogen receptor thus causing a three-dimensional conformational change in PITX1, which is then preventing this repressor from binding to the telomerase promoter resulting in increased telomerase expression.

Estrogen is actually referring to three very related steroids shown below:

Estriol.

Estradiol

Estrone

📷

📷

📷

http://en.wikipedia.org/wiki/Estrogen

Estrogen, TAT2 and TA-65 are sharing a very similar three hexagonal carbon rings and one pentagonal carbon rings However, they differ in their side groups and when compared to estrogen, Cyclostragenol (TAT2) has an extra carbon ring attached to its pentagonal carbon ring, which it is sharing with estrogen. TA-65 again is sharing all carbon rings with TAT2 except that it has 2 extra carbon rings attached to the lower two hexagonal carbon rings.

Due to their chemical similarities, it is reasonable to assume that TAT2 and TA-65 are causing telomerase expression through the same signaling pathway. However, it could also be that either one and/or both of these chemically related compounds are acting through more than one (presumably overlapping) signal transduction pathways.

The mode of action of the estrogen induced signaling cascade is summarized in the schematic representation below:

📷

http://www.qiagen.com/GeneGlobe/Pathways/MNAR-PELP1%20and%20Estrogen%20Receptor%20Interaction.jpg

Analogously to estrogen, as shown in figure above, TA-65 may not only bind to an extracellular receptor domain but also enter the cell similar to estrogen. I am suspecting that it is possible that TA-65 is binding to the telomerase repressor PITX1 and thus preventing it from inhibiting telomerase transcription. Therefore, experiments used to elucidate the mode of action of estrogen could potentially also lead to similar insights regarding the mode of action of TA-65. At least such experiments can either support or rule out that the mode of action of TA-65 is similar to that of estrogen.

It has been shown by Fauce et. al. that inhibition of MAPK and ERK is preventing TAT2 induced telomerase expression but inhibiting the Akt pathway doesn't. The figure below shows that when inhibiting the Akt pathway at 2 different intermediates, telomerase activity is not significantly reduced. If however, the Ras-MAPK pathway in inhibited at ERK and MAPK, then telomerase activity is significantly declining. Moreover there is no more difference in telomerase activity between DMSO (negative placebo control) and TAT2 implying that TAT2 can no longer increase telomerase activity if the Ras pathway is blocked downstream of c-Raf.

📷

The AKT pathway is believed to cause the phosphorylation of a telomerase subunit (Kang et. al.). However, since inhibiting this pathway doesn't significantly reduce telomerase activity, it can be concluded that this phosphorylation doesn't impact TAT2's effect on telomerase activity. Nevertheless, this doesn't necessarily imply that TAT2 is not acting through the AKT pathway too since this anti-apoptotic pathway might cause cells, which would otherwise commit suicide, to survive although it is not increasing telomerase activity. Since the AKT and Ras-MAPK pathway are activated through the same receptors (HGFR, EGFR and IR) as shown in the schema below, it may be hard to show how the Ras-MAPK pathway is activated while the AKT pathway is not. 📷

TA-65 can be labeled with fluorescent lipophilic probes according to protocols of the company Molecular Probes. For more details regarding TA-65 labeling refer to http://www.invitrogen.com/site/us/en/home/References/Molecular-Probes-The-Handbook/Probes-for-Lipids-and-Membranes/Sphingolipids-Steroids-Lipopolysaccharides-and-Related-Probes.html. That way it can be determined whether it is entering the cell. The theoretical ability for TA-65 to penetrate cellular membranes can be evaluated by visualizing whether it can pass through an artificial cell membrane resembling barrier in vitro. Only if there is evidence for TA-65 penetrating cellular membranes, other possible intracellular modes of telomerase activations will be entertained. Alternatively we can add TA-65 to cell culture and visualize whether fluorescently labeled TA-65 is entering the cells using fluorescent microscopy. If TA-65 cannot penetrate a cell membrane, it will be determined to which of the MEK and ERK pathway receptors TA 65 is binding. Based on the pathway schema above, there are at least 3 RTK binding receptor candidates, i.e. HGFR (human growth hormone receptor), EGFR (epithermal growth hormone receptor) and IR (insulin receptor).

Using a similar procedures as used by Fauce et al, it will be used to determine whether TA-65 also uses the Ras pathway to increase telomerase activity. The protocols below are directly taken from Fauce et. al. and adjusted for the use of TA-65

Cell isolation and stimulation

Human peripheral blood samples can be acquired after informed consent or bought from a blood bank. After centrifugation, the PBMC layer can be carefully removed and washed twice in complete RPMI 1640” [10% FBS, 10 mM HEPES, 2 mM glutamine, and 50 IU/ml penicillin/streptomycin]. Purified T cells can be obtained from PBMC using the Pan T isolation kit (Miltenyi Biotec), and, for some experiments, CD8-T cells can be further purified by negative selection using a CD4-T cell isolation kit (Miltenyi Biotec). T cells can be stimulated with CD3/CD28 or CD2/CD3/CD28 Ab-coated beads at a bead:cell ratio of 0.5:1, and PBMC can be stimulated with culture-tested PHA (5–12 _g/ml; Sigma-Aldrich Cat. no.L1668). For short-term stimulation, in addition to PHA or Ab-coated beads, DMSO (0.1%) or TA-65 can be added to wells. Every 48–72 h, half of the media in the wells can be removed and replaced with fresh media containing either DMSO or TA-65. 10 samples each consisting of approximately 10,000 cells are used for the experimental (TA-65 treated) and for the negative control (DMSO treated cell population.

Pathway inhibitors

T cells (1_106/ml), can be isolated and cultured for 7 days with CD2/CD3/CD28 Ab-coated beads (Miltenyi Biotec) and 20 U/ml of IL-2. Cells can then be washed and incubated for 2 h in complete RPMI 1640 containing one of the following inhibitors (Calbiochem): AKT inhibitor 1 (phosphatidylinositol ether analog that potently blocks binding of PIP3 to AKT, Cat. no. 124009), AKT inhibitor 2 (phosphatidylinositol analog that prevents generation of PIP3 by PI3K, Cat. no. 124005), ERK1/2 inhibitor (13-amino acid peptide corresponding to the N terminus of MEK1 (MAPKK), Cat. no. 328000), and MAPK inhibitor PD98059 (blocks the activation of MEK, thus preventing its phosphorylation by cRaf or MEKK, Cat. no. 513000). Then cells can be washed twice with media and re-plated in 24-well plates with complete RPMI 1640. TA-65 or DMSO (0.1%) was can be added to cells, which are harvested 24 h later for the TRAP assay. This is a major experiment for aim 1.

Telomerase activity measurements

Telomerase activity for all experiments can be determined by the telomeric repeat amplification protocol (TRAP), using the reagents, protocol, and calculation details provided in the TRAPeze kit (Millipore; Cat. no.S7710). The amplified TRAP reaction products can be separated on an 8% polyacrylamide gel, and the resulting bands can be probed and analyzed using Packard InstantImager software. Telomerase activity for all samples can be calculated for 10,000 cell-equivalents, according to the TRAPeze kit formula for “Total Product Generated.

Labeling TA-65

TA-65 is labeled according to protocols of Molecular Probes Inc. to determine whether it is entering the cell. If it doesn't, it is likely that it is activating the Ras pathway by binding to an RTK. If it does enter the cell, it could still activate telomerase through the Ras pathway but at the same time impacting telomerase activity other mechanism(s). If it doesn't enter the cell, then we check which natural Ras pathway ligands it is competing away by using each natural Ras pathway activating ligand in combination with a gradually increasing TA-65 concentration. The natural ligand is also labeled to see whether it is binding to the membrane after washing off non-bound TA-65. It will also be determined whether TA-65 is directly or indirectly reducing the binding of the telomerase suppressor PITX1 to the telomerase promoter region. This is a minor experiment for aim1.

Pitfalls for aim 1:

A possible setback to the experiments as written, is the ability to properly replicate the results of the experimental design prior to using it to assay TA-65. Good technical ability is required in each of the various steps in the experiment, for instance a high (>95%) purity should regularly be obtained during the CD8 isolation. We would need to repeat the pathway inhibitor assay using several concentrations of TA-65 to optimize for its affect on Telomerase.

In the event that we are unable to carry out this line of experimentation, we can yet determine which pathway(s) TA-65 is signaling through by measuring the amount of activated signaling intermediates in the Ras- MAPK and AKT pathways using Western Blot (minor experiment).

A difficulty, which would not be resolved by this assay, is which receptor(s) TA-65 may utilize. After the pathway TA-65 uses is discovered, it may be necessary to determine which receptor(s) TAT2 and TA-65 signal through. This may be done by systematically blocking certain receptors that feed into the pathway used, and measuring the effect this has on TA-65's or TAT2's ability to increase Telomerase activity.

Based on the results obtained by the experiments described above, one potential scenario could be that TA-65 is binding to an extracellular receptor domain and simultaneously enters the cell where it is modifying telomerase transcription. The proposed experiments could neither support nor refute this hypothesis. Another scenario might be that TA-65 doesn't impact telomerase transcription but instead is enhancing the function of already existing telomerase holoenzymes.

Due to structural similarity of TA-65 and TAT2 to sterols like estrogen, it may be that TA-65 can be endocytosed into the cytoplasm to its receptor; this is important in predicting what other Telomerase-independent effects that TA-65 may have on the cell. This may possibly be done by conjugating TA-65 with small molecule fluorophores like BODIPY or NBD, then this conjugated TA-65 can be incubated with cultured cells and imaged using live cell fluorescence imaging. If TA-65 can not be endocytosed into the cell its possible effects, or side-effects, are then limited; this question may be of some significance especially when the use of the suspected telomerase activator TA-65 as dietary supplements becomes increasingly common [Harley et al.].

Discussion of aim 2, i.e. measuring the life-long effect of TA-65 on health and life span.

de Jesus at. al. showed that TA-65 is increasing health span but not life span when mice are fed TA-65 over a time period of four months. However, this doesn't exclude the possibility of TA-65 extending lifespan if feed throughout the entire life of the mice. Therefore, we propose to modify the experiments described by de Jesus et. al. by supplementing the diet of telomerase sufficient with TA-65 throughout their life and comparing them with non-TA-65 fed negative controls. The experimental procedures described in detail below.

Mice, cells, and treatments [de Jesus et al 2011]

Age-matched and sex-matched C57BL6 mice can be used as model organisms. Female mice can be obtained directly from the Jackson Laboratories, Inc., Bar Harbor, Maine, USA. Half of the mice can be supplemented with 25 mg of TA-65 per kg of mouse body weight per day, mixed in 100 lL of fruit mash, for their entire lifespan. Fruit mash alone can be supplemented to the control cohorts (100 lL, with the same periodicity as treatment groups). Mice can be daily inspected by an authorized animal facility supervisor, before and after TA-65 treatment. Mice can be sacrificed when presenting signs of illness or tumors. This is a major experiment for aim 2.

Telomere length are measured as described by Fauce et al (below) in order to see whether a potential increase in lifespan is also correlated with longer telomeres.

Telomere length real-time PCR

Isolate splenocytes; DNA can be isolated from cells using DNA easy kit (Qiagen) and diluted to 50 ng/100 μl in dilution buffer. Each ml of buffer consists of: 40 μl of Escherichia coli DNA (100 ng/ μl), 100 μl of 10X Taq polymerase buffer, and 860 μl of H20. DNA samples can be boiled at 95°C for 30 min. Samples can be run in triplicate in a 96-well plate in the I-CycleriQ Multicolor Real-Time Detection System (Bio-Rad). Separate plates can be used for the telomere PCR and the control Human β-Globin (HBG) PCR. In the telomere PCR plate, each well contains 10 μl of DNA, 10 μl of iQ SYBR Green Super Mix, 0.2 μl of Tel primer 1 (20 μM stock), and 0.8 μl of Tel primer 2 (20 μM stock), for a total of 21 μl. In the HBG PCR plate, each well contains 10 μl of DNA, 10 μl of iQ SYBR Green Super Mix, 0.3 μl of HBG primer 1 (20 μM stock), and 0.7 μl of HBG primer 2 (20 μM stock), for a total of 21 μl. The sequences that can be used as primers are: Tel primer 1 (5' CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT 3'), Tel primer 2 (5'GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT 3'), HBG primer 1 (5' GCTTCTGACACAACTGTGTTCACTAGC 3'), and HBG primer 2 (5' CACCAACTTCATCCACGTTCACC 3'). The IQcycler program for the telomere PCR consists of initial denaturation at 94°C for 1 min, followed by 25 PCR cycles at 95°C for 15 s and 56°C for 1 min (single fluorescence measurement). The IQcycler program for the HBG PCR consists of initial denaturation at 94°C for 1 min, followed by 36 PCR cycles at 95°C for 15 s, 58°C for 20 s, and 72°C for 20 s (single fluorescence measurement). Standard curves can be created for both telomere DNA and HBG DNA. Values can be calculated as a ratio of telomere DNA to HBG DNA for each sample, and data can be expressed as % of cell line 1301 telomeric DNA. This acute lymphoblastic T cell line is routinely used in real-time PCR telomere length studies (19, 20). In a separate set of experiments it can be verified that the relative telomere length measurements determined by real-time PCR are correlating well with absolute telomere length measurements using Southern blots of terminal restriction fragments. This is a major experiment for aim 2.

The health span of the mice is determined by using the protocol outlined below as described by Blasco et. al.

Glucose tolerance tests, insulin levels, and Homeostasis model assessment-estimated insulin resistance [HOMA-IR]

Glucose tolerance test and analysis can be performed as described by Moynihan et al., 2005.. Mice can be fasted for at least 6 h and injected intraperitoneally with a 50% dextrose solution (2 g kg)1 body weight). Blood insulin levels can be measured with an Ultra-Sensitive Mouse Insulin ELISA Kit (Crystal Chem Inc., Downers Grove, IL, USA), following the manufacturers protocol. Mice can be fasted for at least 6 h prior to blood insulin analysis. HOMA-IR can be calculated as described by Matthews et al., 1985; and Heikkinen et al., 2007. This is a minor experiment for aim 2.

Bone density, skin measurements, and Hair regrowth

Bone mineral density can be measured in the femur of female mice postmortem using a dual energy X-ray absorptiometry scan device. Subcutaneous fat and epidermal layers measurements can be performed as described by Tomas-Loba et al., 2008). IMAGEJ software can be used for skin length measurements. Hair regrowth assay can be performed and quantified as described by Matheu et al., 2007). Briefly, dorsal hair can be removed by plucking from a square of approximately 1.5 times1.5 cm. Hair regrowth can be scored two weeks later and a semi-quantitative assessment using an arbitrary scale from one to four (where four represents complete hair regeneration). This is a minor experiment for aim 2.

Pitfalls for aim 2:

To minimize experimental errors induced by random events affecting the life and health span of mice, such as infections, which can significantly impact the health and life span of mice, I am proposing to assign 250 telomerase positive mice to each the experimental (TA-65 treated) and the control (placebo treated) mice. Then every month, I could sacrifice 5 mice of each the experimental and the control groups to compare their telomere length and health indicators as described above. Since the previously reported maximum lifespan of such mice are reported to be around 36 months, I'd expect to loose about 180 mice until the end of their maximum lifespan on each, i.e. the experimental and the control group. Then I'd have about 70 mice in each group left that will die a natural death and which I can then use as an indicator for comparing their lifespan.

de Jesus at all showed that 4 months of TA-65 administration to one year and two year old mice is increasing their health span but not their lifespan as shown by the figure from their 2011 publication.

📷

This is surprising and even somewhat counterintuitive because in their 2012 publication the same authors showed that telomerase over-expression using AAV as expression vector increases longevity in mice without increasing the incidence of cancer. Their published results are summarized in the 2 following figures.

📷

📷

These contradicting results may imply that TA-65 is doing more than just activating telomerase and thus counteracting the lifespan extending effects obtained when over-expressing telomerase alone with the help of AAV. It could be that TA-65 is also acting through the Growth Hormone pathway, which has been shown to shorten lifespan (see previous figure in the literature review, which was published by Fontana et. al.) on pathway inhibition that are causing lifespan extension. Also it has been shown that growth hormone can increase telomerase activity through the AKT pathway (Gomez-Garcia et al 2005); thus this proposal aims to resolve these various issues by characterizing the promising natural extract TA-65.

References

�e