The polymorphism, “M242”, is a C→T transition residing in intron 1 (IVS-866) of the DBY gene and was discovered by Mark Seielstad et al. in 2003. The technical details of M242 are:

Nucleotide change: C to T

Position (base pair): 180

Total size (base pairs): 366

Forward 5′→ 3′: aactcttgataaaccgtgctg

Reverse 5′→ 3′: tccaatctcaattcatgcctc

Is Forward 5′→ 3′: aactcttgataaaccgtgctg incomplete and there are more components?

How is Reverse 5′→ 3′: tccaatctcaattcatgcctc calculated? Does the Nucleotide change: C to T have an effect on calculating Reverse 5′→ 3′: tccaatctcaattcatgcctc?

More Daniel Winarski's questions See All
Similar questions and discussions