The polymorphism, “M242”, is a C→T transition residing in intron 1 (IVS-866) of the DBY gene and was discovered by Mark Seielstad et al. in 2003. The technical details of M242 are:
Nucleotide change: C to T
Position (base pair): 180
Total size (base pairs): 366
Forward 5′→ 3′: aactcttgataaaccgtgctg
Reverse 5′→ 3′: tccaatctcaattcatgcctc
Is Forward 5′→ 3′: aactcttgataaaccgtgctg incomplete and there are more components?
How is Reverse 5′→ 3′: tccaatctcaattcatgcctc calculated? Does the Nucleotide change: C to T have an effect on calculating Reverse 5′→ 3′: tccaatctcaattcatgcctc?
The forward and reverse are the sequences of the PCR primers that amplify the region containing the SNP. BLAST them in the human genome to get the rest of the sequence.
Honestly, this sounds like a question from an undergraduate homework assignment. But on the off chance that you are a Ph.D student and this isn't for a graded assignment, I suggest that you ask someone in your lab group for help.
P.S. No, the SNP will NOT be in the primer. Otherwise your amplified DNA will all have that change.
good luck!
Hi, I am almost 73 years old and earned my PhD in mechanical engineering (not genomics) almost half-a-century ago. No, this is not a homework assignment. I sincerely thank you for your insight of where to find the rest of the sequence and I will follow your valued advice. Thank you so very much!
Daniel Winarski Wow! Sorry that my first reply was a bit rude, but we do get a lot of folks trying to cut corners on their personal research project (or even homework) on this site.
The reverse primer will match as a reverse complement to the coding strand given in the human genome. The first letter of the 5' end of the forward primer and the letter that complements the 5' end of the reverse primer will be 366 bp apart (product size includes the length of the primers).
Thanks so very much. I perfectly understand about people potentially abusing Researchgate, trying to cut corners on assignments, so I fully agree with your earlier comments. I have used BLAST in a recent Coursera course, so I will review my notes and "blast away." Thanks again, Dan
- Badges
- Science method
- Similar topics
- Mathematics
- Statistics
- Statistical Techniques
- Meta-Analysis