Daniel Winarski

4 Questions 3 Answers 0 Followers

Questions related from Daniel Winarski

What APDL command would I use to get the absolute displacement of select nodes?

Hi, I have identified a small set of 38 "nodes of interest" in an ANSYS finite element model (>17,000 nodes total). I would like to get the absolute displacement of this subset of 38 nodes at...

01 July 2025 8,011 2 View

Getting the ANSYS "Nearest Node" Node(X,Y,Z) command to recognize nodes?

I am a 76-year-old retiree trying to use ANSYS 2025R1. I wish to find the nearest node to some specific (X,Y,Z) locations. All I read on the Internet is to use the "nearest_node=Node(X,Y,Z)"...

29 June 2025 3,590 4 View

Can someone please show me how to calculate Reverse 5′→ 3′: tccaatctcaattcatgcctc for the Q-M242 Human Y-Haplogroup?

The polymorphism, “M242”, is a C→T transition residing in intron 1 (IVS-866) of the DBY gene and was discovered by Mark Seielstad et al. in 2003. The technical details of M242 are: Nucleotide...

18 August 2021 6,609 4 View

Proving Goldbach Strong Conjecture, assuming Goldbach weak theorem is valid.

https://www.researchgate.net/publication/370211772_chatGPT_translation_of_Itzhack_Hebrew_proof_of_the_strong_Goldbach_conjecture At the above link is an attempt to prove the Goldbach strong...

01 January 1970 8,714 0 View