Anyone have a list of Open Access Journals in Computer Science?

More Khawar Islam's questions See All

Has anyone applied Python in the field of textile engineering for data analysis, automation, or smart textiles?

I'm currently exploring the application of Python in textile engineering, specifically in areas like data analysis, process automation, and the development of smart textiles. I'm interested in...

10 August 2024 7,429 2 View

How to use ERP System in Global University ?

27 July 2024 8,229 0 View

How can I prepare the csv. dataset to find the flood triggaring factor using ANN?

here's a concise guide for preparing your CSV dataset in Excel to identify flood-triggering factors using an ANN: Clean and Format:Address missing values (fill with mean/median or remove if...

21 June 2024 7,941 0 View

How do integrate ECG, PCG, and clinical data to apply early fusion multimodal?

how do integrate ECG, PCG, and clinical data to apply early fusion multimodal?

10 June 2024 3,289 1 View

How can I make complex file of ligand (including flexible residues from protein) with protein Structure after AutodockFR docking?

I have performed the Molecular Docking using ADFR suite, I have obtained the files in _out.pdbqt format for ligand docked poses, upon inspection, both visually and reading the pdbqt files of...

08 June 2024 8,130 2 View

Could anyone suggest me which filter paper would be best for filtration process?

Dear Respected Scholars, I am working on detection of microplastic in prawn. Although, all the other parameters assessed smoothly but I have encounterd a problem during isolation of microplastics...

05 June 2024 2,469 0 View

How can I select the exact value in Flow Accumulation to identify the streams during Basin delineation?

In basin delineation and hydrological modeling, selecting the exact value in Flow Accumulation to identify streams is a critical step. The Flow Accumulation tool calculates the accumulated flow as...

30 May 2024 6,107 1 View

Are multi-level models appropriate for binary outcome variables for DHS datasets? If yes, what is the process?

30 May 2024 2,035 2 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,777 1 View

Hello Everyone ! I'm looking for a good journal to publish my manuscript with low publication cost?

I am Looking for a Science Journal with good impact factor and low publication cost to publish a review paper. Your suggestions would be appreciated.

06 August 2024 6,796 3 View

How to report results of Generalised Linear Mixed Models in a journal article?

Hi everyone, If you have written or come across any papers where Generalised Linear Mixed Models are used to examine intervention (e.g., in mental health) efficacy, could you please share the...

04 August 2024 4,130 4 View

Why do open and free science in a world where science is not open and free?

Because I have realized that the world tends more and more to do open and free science and there is a trend more and more to choose free databases, free tools and open access platforms.

01 August 2024 10,046 1 View

Good day!! All, can anyone recommend the best battery related journals to download research articles please?

I am an Mphil research student and looking for high impact factor battery related journals to download and read research articles to improve my knowledge and get new ideas in the field of battery...

01 August 2024 6,516 2 View

About impact factor?

I have been publishing the Nepalese Journal of Agricultural Sciences (online ISSN 2091-0428; print ISSN 2091-042X) on www.nepjas.com and research gate. I was wondering how I can get an impact...

01 August 2024 1,277 1 View

Is the peer-reviewed publication "MedieKultur: Journal of Media and Communication Research" (E-ISSN 1901-9726, P-ISSN : 0900-9671) a legitima?

Is the peer-reviewed publication "MedieKultur: Journal of Media and Communication Research" (ISSN Online: 1901-9726, ISSN Print: 0900-9671) a legitimate and credible scholarly journal in the field...

01 August 2024 629 3 View

Why can't academics earn the money they deserve?

Only Journals make money from the articles we have worked on for years. Academics do not earn money from their refereeing. Then shouldn't the solution be a system in which academics can earn...

01 August 2024 6,469 6 View

Culture fibroblasts with or without FGF2?

I'm new to primary human fibroblast culture and I'm studying aging using cells from old and young donors. Some research groups have used media supplemented with FGF2, so I cultured cells in the...

29 July 2024 3,030 2 View

What is the relationship between the threshold voltage and the device's noise performance, particularly in terms of flicker noise and thermal noise?

The threshold voltage (Vth) of a MOS device plays a crucial role for its operation. At the same time, noise is an intrinsic factor. So how noise (flicker or thermal) change with the change in...

29 July 2024 3,246 0 View

Is factor analysis with quantitative variables possible?

Good morning, I would like to conduct a factor analysis for my work at the municipal level on a panel datae with variables such as income per capita, unmployement rate, percentage employed in a...

25 July 2024 5,104 4 View

Ali H. Wheeb

kindly, see link below

https://www.scopus.com/sources?sortField=citescore&sortDirection=desc&isHiddenField=false&field=subject&subject=com&asjcs=17&Apply=Apply&openAccess=true&_openAccess=on&_countCheck=on&count=0&countField=documentsMin&_bestPercentile=on&_quartile=on&_quartile=on&_quartile=on&_quartile=on&_type=on&_type=on&_type=on&_type=on&year=2017&offset=&resultsPerPage=20

Jamilu Sabi'u

You just google springer, hindawi, Elsevier, Nature, Taylor and Francis and many more for some good open access Journals.

However, you have to be careful with predatory Journals

Nikolaos Polatidis

Some are, computer science and information systems, journal of universal computer science, journal of machine learning research and journal of artificial intelligence research.