The following are sequences of Staphylokinase gene of Staphylococcus aureus bacteria
How can I amplified the gene with these primers using NCBI (in silico)
Forward primer: 5' - CGCGGATCCTCAAGTTCATTCGAC - 3'
Reverse primer: 5' – CCCAAGCTTTTTCCTTTCTATAACAAC -3'
You would need to select the appropriate genome and input the primer sequences. With a genome this size, it might be simpler to analyze it with desktop sequence analysis software or even manually. The NCBI tool is most useful for pcr from large genomes such as human or mouse, where it will identify potential background products that could yield false positives.
Hi, in addition to that expressed by other colleagues, you can also use the tool given in this page.
http://insilico.ehu.es/PCR/
PCR may be simulated against up-to-date sequenced prokaryotic genomes. This service allows a maximum of 2 mismatches between primers and template, so the stringency of in silico PCR must be consider high.
Dear : Stephen Ayers, Nur Aini, and Oscar De La Rosa
I would like to acknowledge you how much I appreciate your cooperation with me . Really I'm very grateful for you
Yours sincerely
Ali A. Ibrahim
- Badges
- Science topic
- Similar topics
- Biological Science
- Bioscience
- Biotechnology