6 Questions 14 Answers 0 Followers
Questions related from Musa Mohammadi
We are looking for some viral disease on Tuberose, what do you think of this symptom? The main goal is detection of Tuberose mild mosaic virus, please check this paper to compare symptoms: First...
23 September 2021 4,013 3 View
I'm doing some research on plant virus metagenomics, I'm confused with removing host (plants) RNA sequences. Different methods yield different mapping results, 95% mapping to the genome and 78%...
03 April 2020 6,708 0 View
I want to buy a new laptop to analysis NGS data without server. But I don't know about hardware requirement for NGS analysis. is it possible to analysis these kind of data on a laptop?
12 August 2017 3,984 3 View
I'm interested in RNAi. I found some article about precursor miRNA in human viruses. but I want to know if there is any precursor miRNA in plant viruses. if you read some article about precursor...
20 November 2015 7,347 1 View
I amplified a gene(np gene of TSWV) form total RNA. total RNA was extracted from leaf of tobacco. I had used these primer pair: F : ATGTCTAAGGTTAAGCTCACTA R : TTAAGCAAGTTCTGTGAGTT these primer...
26 October 2015 3,175 8 View
I have collected several samples from tobacco filed, I'm looking for TSWV. I need to purify TSWV from other viruses in my samples. what should I do? I afraid of mixed infection in my samples with...
26 October 2015 7,302 5 View