Ramesh Kumar Krishnan

2 Questions 6 Answers 0 Followers

Questions related from Ramesh Kumar Krishnan

Will three missing nucleotides on the 3' end of the forward primer result in no annealing?

Hello everyone, I ordered forward and reverse primers for oligo annealing for guided RNA cloning. Instead of this primer (5' CTTCGCTAGAGGCGTGGCCAGGGG 3'), I ordered this...

26 March 2020 680 5 View

How to segment actin filaments on a cryo tomogram?

Hello everyone, I have cryo tomograms which shows actin bundles as features of interest. I need to segment them and create a 3D representation. I used some software...

19 December 2019 2,150 7 View