3 Questions 7 Answers 0 Followers
Questions related from Ramesh Kumar Krishnan
Hello everyone, I ordered forward and reverse primers for oligo annealing for guided RNA cloning. Instead of this primer (5' CTTCGCTAGAGGCGTGGCCAGGGG 3'), I ordered this...
26 March 2020 933 5 View
Hello everyone, I have cryo tomograms which shows actin bundles as features of interest. I need to segment them and create a 3D representation. I used some software...
19 December 2019 2,229 7 View
Hi, I'm trying to understand the protocol to make the CRISPR mutant stock. I have transgenic Vasa cas 9 (X chromosome) and gRNA (2nd chromosme) flies. I start by crossing cas 9 males with gRNA...
05 December 2019 2,610 2 View